GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 11:24:09, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XR_003620244            3586 bp    RNA     linear   MAM 12-FEB-2019
DEFINITION  PREDICTED: Eptesicus fuscus NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X3, misc_RNA.
ACCESSION   XR_003620244
VERSION     XR_003620244.1
DBLINK      BioProject: PRJNA232522
KEYWORDS    RefSeq.
SOURCE      Eptesicus fuscus (big brown bat)
  ORGANISM  Eptesicus fuscus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Vespertilionidae; Eptesicus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_007370697.1) annotated using gene prediction method: Gnomon,
            supported by mRNA evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Eptesicus fuscus Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3586
                     /organism="Eptesicus fuscus"
                     /mol_type="transcribed RNA"
                     /isolate="BU_THK_EF1"
                     /db_xref="taxon:29078"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="USA: Massachusetts"
     gene            1..3586
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 2 mRNAs, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     23 samples with support for all annotated introns"
                     /db_xref="GeneID:103292235"
     misc_RNA        1..3586
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X3"
                     /db_xref="GeneID:103292235"
ORIGIN      
aatgcataaagcctggttgccttttaggccacacttgttacatggcttttgcttaatccacagcctcgtatcacagaggatttcagtctgaaatattttagagtgtgtcaaagccccatgccccgtgaaataaaaatttcatggattaccttcagcctctgtggactattctgaatgtctggctgacattggctgtgaaggaggatgccagctggtcagatggatttcctgctgtagaaatcatactgagctcgtttcattggtcttttctctcttttgcatgtgcagagttagattggctgagcaacccaagcttttgtgttgaaaccgtcccaactctgagccaacaaactgaagaggccgcagctcttgtgtctgaagggtcaccgctgacgaggagtcccccgaaatcagagctgtcagatgaaagtgactcgaacagaaacctccgacaagcaagcaggaaaaagaagaaagagaaaaggaagaaaaggaagcatcagcaccacaagaaaaccaagaggaaacgcgggcagtcaggtagcagtgggtctgagccagacactgactctgaaaaggacaaatcccccagaggcctcagaggcggtaacagaggaccggagacactgagccaagaaaatgctgctgctgctgggccccgctgtgtttggcttgaggacatccaggctctgacaggagaaaccttcagaacagataagaaaccagatcctgcaaactgggagtacaagtctctctaccgaggagatatagcaagatacaagaggaaaggaaactcctgccttggcattaactctaagaagcagtgcatatcctgggagggggctcccacgggaaagaagcgtgcgcaccagcatgtagagcgctatttcacgaagaagaacgtggggttgatgagcaccgatggagttgccgttagcagtaaaacggaccctccctcgtctgcgcccatctcctttatcccagtgaaggactcggacgatgtggttcctcctgttacaacctggttgaaccctctggggatttatgatcaatccaccacccagtggttacaaggacaaggtcctgcagagcaggaatccaagcagccggactcacagccagaccgtgagaacgcgctgctcaaggccagggtggaggagtttaacaggagggtgcgggagaatcctcgggatactcagctgtggatggcgttcgttgcttttcaggacgaggtcatgagaagccctggcctgtatgccatcgaggaaggcgagcaggagaagcggaagaggtccctgaagctcatcctggagaagaagctggccattctggagcgggccatcgacagcaacccgagcagcgtggacctgaagctcgccaagctgaagctctgcacggagttctgggagccctccatgctggtcaaagagtggcagaaactgatattcctacaccccaacaatacagccctttggcagaaataccttttgttttgccagagccagttcagcaccttttcaatatcaaaaattcacagcctttatgggaaatgcttgagtacattgtctgctgtgaaggacggcagcatcttatctcaccctgagctgcctggcaccgaagaggccatgtttgcgctctttcttcagcagtgccacttcctgcgccaggccgggcacgcggagaaggccgtctccttgttccaggccatggtcgacttcaccttcttcaaacccgacagcgtcaaagatctgcccaccagaggacaggtggagttctttgagcccttttgggacagtggagagccccgggctggggagaagggcgcccgaggctggcgagcgtggatgcaccagcaggagcggggcggctgggtggtcatcaacccagatgatgatgatgatgagccagaagaggatgaccaggacatcagagataagactctgcccaggtggcagatctggcttgctgctgagcgatcccgagaccagaggcactggcggccgtggcgccctgataagaccaagaagcaaacggaggaagactgtgatgatccagagagacaggtgctgtttgatgatattggacaatctctgatccggctttccagccacgctcttcagttccagctgattgtggcctttctgcagttcttgggtgtgcctgctggcttcagccctccagcctcctgcctctacctggccatggatgagaacagcatcttcgataacggactttatgacgaacagccattgacttctctcaacctttcattttctggcgtcagctgtgtcggtcgcacggaccagttgggctgtcggcgctggaccaggggtcacagccgagagggcgaggagttcatccgcaacatcttccacctggtgatgcctttgttttcaggcacggagaggtcccagctctgctcctcctggctacggtacgagattgcaaaggtcatttggtgtctgcacactaaaaacaagaagaggttaaaatcacgaggaaagaactgcaaaaaactagccaagaatctccttaaggagccagaaaaccgcaacaacgtttgcctctggaagcagtatgcacatctggaatggttgcttggcgacacagaggacgccagaaaagttttcgatacagcactcagctcggcagggagcggggagctgaaggaccctgaggtctgtgagctcagtctgctctatgctgagctggagctggagctggcgccagacaccagagtggccaccgcggcccgagctgttcacatactaaccaggctggctgagagtggtccctatgggccctacactgggcaagtcctggccgttcacattttgaaagctcggaaggcttacgaacatgcactgcaggactgtttgggtgagagctgtgtctccgatccagccgccaccacctcccttaaccgcctagttagcgtggttaaatgctttatgctcttccagtatttgaccatagggatcgatgccgctgtgcagatacacgagcaggtgtttgcaaaactgaagggctctctttccccagaaggcctgggcctggaggacagtgcctgccccccgagtgtgagcagcgtcctcgaggcggtcacactgatgcacacgagcctgctcaggttccacatgaaagtcagcgtttaccctctggctcctctgcggctggcgctctcagaggctttaaagttgtatccaggcaaccaggttctttggaggtcctacgttcaggttcagaacaagtcccacagcgccagcaagaccaggaggttcttcgatgcagtcaccaggtctgcgagacccttggagccgtggttgtttgccattgaagctgagaaaatgaggaaaaggctggtggagaccgtccagagatggcagagaggtctacgccacaattcctgagaccggcttgacgcaccggatcagagccctgtttgaaaacgcgatccggagtgagcacggcagccagtgccccttactgtggaggatgtacttgagctttttggtttcgttaggaaataaggacagaagcaagggtgtgttctacaaagcacttcagagttgtccttgggcaaagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]