2024-04-20 15:39:15, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_003582754 399 bp RNA linear ROD 21-MAY-2020 DEFINITION PREDICTED: Marmota flaviventris uncharacterized LOC114092506 (LOC114092506), ncRNA. ACCESSION XR_003582754 VERSION XR_003582754.1 DBLINK BioProject: PRJNA516936 KEYWORDS RefSeq. SOURCE Marmota flaviventris (yellow-bellied marmot) ORGANISM Marmota flaviventris Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Sciuromorpha; Sciuridae; Xerinae; Marmotini; Marmota. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023144746.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Marmota flaviventris Annotation Release 101 Annotation Version :: 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..399 /organism="Marmota flaviventris" /mol_type="transcribed RNA" /isolate="SJ_83" /db_xref="taxon:93162" /chromosome="Unknown" /sex="female" /tissue_type="blood" /dev_stage="adult" gene 1..399 /gene="LOC114092506" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:114092506" ncRNA 1..399 /ncRNA_class="lncRNA" /gene="LOC114092506" /product="uncharacterized LOC114092506" /db_xref="GeneID:114092506" ORIGIN
gggagggcgggctgaggtgggcggccagtcgacctttacctttcttggctcgtcctgttggggcatgcttttcctgctggtcaggaggagacgggggctaaaaaacctgacaattctccatggactgaagttttgacttggcatgagggcttcctatggaaaagaggcttgctgagtttgaagcttggagcttgaagagcatggcaccaacatctgttcaggacctccttgctgttcacaatatggcatcatggctagcacatgaaagaaattgttggcctgtatttaatcaaaaagaagggctaagaagaaccttcacatgcagttcacatcaaccctggggcaactgaaaggtcaggatgacctattatggcagagaaaaggaaaaaattaatggga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]