2024-05-05 07:20:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_003548740 77 bp RNA linear MAM 23-JAN-2019 DEFINITION PREDICTED: Tupaia chinensis small nucleolar RNA SNORA31 (LOC114007086), ncRNA. ACCESSION XR_003548740 VERSION XR_003548740.1 DBLINK BioProject: PRJNA221634 KEYWORDS RefSeq. SOURCE Tupaia chinensis (Chinese tree shrew) ORGANISM Tupaia chinensis Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Scandentia; Tupaiidae; Tupaia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_006159448.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Tupaia chinensis Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..77 /organism="Tupaia chinensis" /mol_type="transcribed RNA" /db_xref="taxon:246437" /chromosome="Unknown" /sex="male" /country="China" gene 1..77 /gene="LOC114007086" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:114007086" ncRNA 1..77 /ncRNA_class="snoRNA" /gene="LOC114007086" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:114007086" /db_xref="RFAM:RF00322" ORIGIN
ctgcattcacagatagaccttgaacagtctggtattgttctacagtttgttccaggatgtgagaggaaaaaacatct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]