GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-05 07:20:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_003548740              77 bp    RNA     linear   MAM 23-JAN-2019
DEFINITION  PREDICTED: Tupaia chinensis small nucleolar RNA SNORA31
            (LOC114007086), ncRNA.
ACCESSION   XR_003548740
VERSION     XR_003548740.1
DBLINK      BioProject: PRJNA221634
KEYWORDS    RefSeq.
SOURCE      Tupaia chinensis (Chinese tree shrew)
  ORGANISM  Tupaia chinensis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Scandentia; Tupaiidae;
            Tupaia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006159448.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Tupaia chinensis Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..77
                     /organism="Tupaia chinensis"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:246437"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="China"
     gene            1..77
                     /gene="LOC114007086"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:114007086"
     ncRNA           1..77
                     /ncRNA_class="snoRNA"
                     /gene="LOC114007086"
                     /product="small nucleolar RNA SNORA31"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00322"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:114007086"
                     /db_xref="RFAM:RF00322"
ORIGIN      
ctgcattcacagatagaccttgaacagtctggtattgttctacagtttgttccaggatgtgagaggaaaaaacatct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]