GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-26 00:49:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_003531978             125 bp    RNA     linear   VRT 11-JAN-2019
DEFINITION  PREDICTED: Corapipo altera uncharacterized LOC113960110
            (LOC113960110), ncRNA.
ACCESSION   XR_003531978
VERSION     XR_003531978.1
DBLINK      BioProject: PRJNA512899
KEYWORDS    RefSeq.
SOURCE      Corapipo altera (White-ruffed manakin)
  ORGANISM  Corapipo altera
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Pipridae; Corapipo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_020885082.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Corapipo altera Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..125
                     /organism="Corapipo altera"
                     /mol_type="transcribed RNA"
                     /isolate="COAL_440"
                     /db_xref="taxon:415028"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver and muscle"
                     /dev_stage="adult"
                     /country="Costa Rica: Volcan Tenorio National Park"
                     /lat_lon="10.40 N 85.0 W"
                     /collection_date="2017"
     gene            1..125
                     /gene="LOC113960110"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:113960110"
     ncRNA           1..125
                     /ncRNA_class="lncRNA"
                     /gene="LOC113960110"
                     /product="uncharacterized LOC113960110"
                     /db_xref="GeneID:113960110"
ORIGIN      
aggtgtggattgctgagtgataaactgagaaaatgattcgggctaattaagaggaaacagtgtaaggtcaatatgacctggagagagaaaagaaaaacaaatcgtaaaacttaattgggctccta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]