2024-04-26 00:49:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_003531978 125 bp RNA linear VRT 11-JAN-2019 DEFINITION PREDICTED: Corapipo altera uncharacterized LOC113960110 (LOC113960110), ncRNA. ACCESSION XR_003531978 VERSION XR_003531978.1 DBLINK BioProject: PRJNA512899 KEYWORDS RefSeq. SOURCE Corapipo altera (White-ruffed manakin) ORGANISM Corapipo altera Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Pipridae; Corapipo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_020885082.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Corapipo altera Annotation Release 100 Annotation Version :: 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..125 /organism="Corapipo altera" /mol_type="transcribed RNA" /isolate="COAL_440" /db_xref="taxon:415028" /chromosome="Unknown" /sex="female" /tissue_type="liver and muscle" /dev_stage="adult" /country="Costa Rica: Volcan Tenorio National Park" /lat_lon="10.40 N 85.0 W" /collection_date="2017" gene 1..125 /gene="LOC113960110" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:113960110" ncRNA 1..125 /ncRNA_class="lncRNA" /gene="LOC113960110" /product="uncharacterized LOC113960110" /db_xref="GeneID:113960110" ORIGIN
aggtgtggattgctgagtgataaactgagaaaatgattcgggctaattaagaggaaacagtgtaaggtcaatatgacctggagagagaaaagaaaaacaaatcgtaaaacttaattgggctccta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]