2025-09-14 10:47:13, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS XR_003480888 277 bp RNA linear ROD 10-JUL-2020 DEFINITION PREDICTED: Cricetulus griseus uncharacterized LOC103163642 (LOC103163642), ncRNA. ACCESSION XR_003480888 VERSION XR_003480888.2 DBLINK BioProject: PRJNA498699 KEYWORDS RefSeq. SOURCE Cricetulus griseus (Chinese hamster) ORGANISM Cricetulus griseus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Cricetidae; Cricetinae; Cricetulus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_023276807.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process On Jul 10, 2020 this sequence version replaced XR_003480888.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cricetulus griseus Annotation Release 104 Annotation Version :: 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..277 /organism="Cricetulus griseus" /mol_type="transcribed RNA" /strain="17A/GY" /isolation_source="Laboratory Animal" /db_xref="taxon:10029" /chromosome="1" /map="unlocalized" /sex="female" /tissue_type="liver" /geo_loc_name="USA: Baltimore, MD" /lat_lon="39.299625 N 76.593518 W" /collection_date="2014-04-16" /note="pooled liver cells from 5 individuals" gene 1..277 /gene="LOC103163642" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 4 samples with support for all annotated introns" /db_xref="GeneID:103163642" ncRNA 1..277 /ncRNA_class="lncRNA" /gene="LOC103163642" /product="uncharacterized LOC103163642" /db_xref="GeneID:103163642" ORIGIN
tatagactgctgcatgctggctggctaggttgctctttttaacttagaaagttgaggaaacaacaaagtagaggatgaatggtatctggaggttgacatactgatactcggggaaggtacagatgtgaatttcagcatgaagaaaggaagatattttctgttgttcaaggatgagacataccatatgagagggagccactataggtccaagaagagattgggaccatggagatttccagagacctacaaggatgacatgatctcataatcaaggcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]