LOCUS       XR_003480888             277 bp    RNA     linear   ROD 10-JUL-2020
DEFINITION  PREDICTED: Cricetulus griseus uncharacterized LOC103163642
            (LOC103163642), ncRNA.
ACCESSION   XR_003480888
VERSION     XR_003480888.2
DBLINK      BioProject: PRJNA498699
KEYWORDS    RefSeq.
SOURCE      Cricetulus griseus (Chinese hamster)
  ORGANISM  Cricetulus griseus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Cricetidae; Cricetinae; Cricetulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_023276807.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 10, 2020 this sequence version replaced XR_003480888.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cricetulus griseus Annotation
                                           Release 104
            Annotation Version          :: 104
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..277
                     /organism="Cricetulus griseus"
                     /mol_type="transcribed RNA"
                     /strain="17A/GY"
                     /isolation_source="Laboratory Animal"
                     /db_xref="taxon:10029"
                     /chromosome="1"
                     /map="unlocalized"
                     /sex="female"
                     /tissue_type="liver"
                     /geo_loc_name="USA: Baltimore, MD"
                     /lat_lon="39.299625 N 76.593518 W"
                     /collection_date="2014-04-16"
                     /note="pooled liver cells from 5 individuals"
     gene            1..277
                     /gene="LOC103163642"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 4 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:103163642"
     ncRNA           1..277
                     /ncRNA_class="lncRNA"
                     /gene="LOC103163642"
                     /product="uncharacterized LOC103163642"
                     /db_xref="GeneID:103163642"
ORIGIN      

tatagactgctgcatgctggctggctaggttgctctttttaacttagaaagttgaggaaacaacaaagtagaggatgaatggtatctggaggttgacatactgatactcggggaaggtacagatgtgaatttcagcatgaagaaaggaagatattttctgttgttcaaggatgagacataccatatgagagggagccactataggtccaagaagagattgggaccatggagatttccagagacctacaaggatgacatgatctcataatcaaggcaa

//