GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:39:30, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_003480888             266 bp    RNA     linear   ROD 18-DEC-2018
DEFINITION  PREDICTED: Cricetulus griseus uncharacterized LOC103163642
            (LOC103163642), ncRNA.
ACCESSION   XR_003480888
VERSION     XR_003480888.1
DBLINK      BioProject: PRJNA498699
KEYWORDS    RefSeq.
SOURCE      Cricetulus griseus (Chinese hamster)
  ORGANISM  Cricetulus griseus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Cricetidae; Cricetinae; Cricetulus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_020822425.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cricetulus griseus Annotation
                                           Release 103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..266
                     /organism="Cricetulus griseus"
                     /mol_type="transcribed RNA"
                     /strain="17A/GY"
                     /isolation_source="Laboratory Animal"
                     /db_xref="taxon:10029"
                     /chromosome="1"
                     /map="unlocalized"
                     /sex="female"
                     /tissue_type="liver"
                     /country="USA: Baltimore, MD"
                     /lat_lon="39.299625 N 76.593518 W"
                     /collection_date="2014-04-16"
                     /note="pooled liver cells from 5 individuals"
     gene            1..266
                     /gene="LOC103163642"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 14 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:103163642"
     ncRNA           1..266
                     /ncRNA_class="lncRNA"
                     /gene="LOC103163642"
                     /product="uncharacterized LOC103163642"
                     /db_xref="GeneID:103163642"
ORIGIN      
ggtatagactgctgcatgctggctggctaggttgctctttttaacttagaaagttgaggaaacaacaaagtagaggatgaatggtatctggaggttgacatactgatactcggggaaggtacagatgtgaatttcagcatgaagaaaggaagatattttctgttgttcaaggatgagacataccatatgagagggagccactataggtccaagaagagattgggaccatggagatttccagagacctacaaggatgacatgatctc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]