ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2025-11-18 11:29:51, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_003374214 153 bp RNA linear VRT 11-OCT-2018
DEFINITION PREDICTED: Pseudonaja textilis uncharacterized LOC113437314
(LOC113437314), ncRNA.
ACCESSION XR_003374214
VERSION XR_003374214.1
DBLINK BioProject: PRJNA495355
KEYWORDS RefSeq.
SOURCE Pseudonaja textilis
ORGANISM Pseudonaja textilis
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
Toxicofera; Serpentes; Colubroidea; Elapidae; Hydrophiinae;
Pseudonaja.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NW_020769326.1) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI
Annotation Status :: Full annotation
Annotation Name :: Pseudonaja textilis Annotation
Release 100
Annotation Version :: 100
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 8.1
Annotation Method :: Best-placed RefSeq; Gnomon
Features Annotated :: Gene; mRNA; CDS; ncRNA
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..153
/organism="Pseudonaja textilis"
/mol_type="transcribed RNA"
/db_xref="taxon:8673"
/chromosome="Unknown"
gene 1..153
/gene="LOC113437314"
/note="Derived by automated computational analysis using
gene prediction method: Gnomon. Supporting evidence
includes similarity to: 100% coverage of the annotated
genomic feature by RNAseq alignments, including 1 sample
with support for all annotated introns"
/db_xref="GeneID:113437314"
ncRNA 1..153
/ncRNA_class="lncRNA"
/gene="LOC113437314"
/product="uncharacterized LOC113437314"
/db_xref="GeneID:113437314"
ORIGIN
acaatcatccaatggaacagcttgccatcagaagctgtgagtacttcatcacttgagactttcaagaagagattggactgtcatttttcagaaatggtgtaggtctcctgcttgggcaggggtttggactagattacctacaaggtcttttcc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]