LOCUS       XR_003351493             267 bp    RNA     linear   PLN 02-OCT-2018
DEFINITION  PREDICTED: Papaver somniferum uncharacterized LOC113332400
            (LOC113332400), ncRNA.
ACCESSION   XR_003351493
VERSION     XR_003351493.1
DBLINK      BioProject: PRJNA492326
KEYWORDS    RefSeq.
SOURCE      Papaver somniferum (opium poppy)
  ORGANISM  Papaver somniferum
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Ranunculales; Papaveraceae;
            Papaveroideae; Papaver.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_039358.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Papaver somniferum Annotation
                                           Release 100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..267
                     /organism="Papaver somniferum"
                     /mol_type="transcribed RNA"
                     /cultivar="HN1"
                     /db_xref="taxon:3469"
                     /chromosome="1"
                     /tissue_type="leaves"
                     /dev_stage="seedling"
                     /geo_loc_name="Australia"
     gene            1..267
                     /gene="LOC113332400"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 9 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:113332400"
     ncRNA           1..267
                     /ncRNA_class="lncRNA"
                     /gene="LOC113332400"
                     /product="uncharacterized LOC113332400"
                     /db_xref="GeneID:113332400"
ORIGIN      

gaagaagctggcagcactgaaaccagagaatagcactgtcaatgagtgggaagagttcgtgaaacatgtttgctcggaggaattcagaacaaaaagattctggatgcaacaaatcaggaagaaatacaccactccacacactatcagtagactgggttgggtgagactcgaggctaagatgcaaaaggaacggaaaacacaagaagagattgatagagtcgaagtttggacaacgggtcacaaacataaggaaggaaaggaacctaa

//