GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:56:52, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_003085677            3603 bp    RNA     linear   VRT 24-MAY-2018
DEFINITION  PREDICTED: Python bivittatus NRDE-2, necessary for RNA
            interference, domain containing (NRDE2), transcript variant X3,
            misc_RNA.
ACCESSION   XR_003085677
VERSION     XR_003085677.1
DBLINK      BioProject: PRJNA238085
KEYWORDS    RefSeq.
SOURCE      Python bivittatus (Burmese python)
  ORGANISM  Python bivittatus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Lepidosauria; Squamata; Bifurcata; Unidentata; Episquamata;
            Toxicofera; Serpentes; Henophidia; Pythonidae; Python.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_006535520.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Python bivittatus Annotation Release
                                           102
            Annotation Version          :: 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3603
                     /organism="Python bivittatus"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:176946"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="liver"
                     /country="USA: Texas"
     gene            1..3603
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 Protein, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 5 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:103064229"
     misc_RNA        1..3603
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X3"
                     /db_xref="GeneID:103064229"
ORIGIN      
cccagtgaaactacatttcccagcatgctcgggaaaagagtccgcgccatcttgtctccttccctcctctgtcgctggaggaggccgcggaagtcgtgattctcgagggtttcgtggcttgtgatggctctttttcctgcctttgccgatgctgctaaagctggagacgtacaagcaagcgaaggctcgaaaagagatttgaactggctgactaatcaaagcttttgcaatgaagatgcactgagattgcaccaaaatgctttagaaattacagactgtgaaccttcactccaaagcagtacagccaccagttttgaactcccaggagaaaatgaagccaacaaatgtttccaagtgtcacctaaaaagagaaagaaaaagaaaaagcaacgagatcacaaaaaaaataaaaagaaaaggagaaaggaatggagcactagtggatctgaatctgaggatgggaaagatgatagaaatattgaaaaaagaggaacagaattgaacttagaagataaaaccacaaatgtgccctatccgtctgtttggcttgatgacattcagggtttgatggcagaaggattcaaaacagataagaagccagatcctgcaaattggcagtataaatcactatatcgaggcaacattgcaaggtataagagacgaagcaacttctgccttggcctccaacctaaggagcaacatatcatttgggagagctcagcagctggaaaaaagtcttcctataagcggccagaacgctacttcacaaaaggtggtcggaagctcctgaacatggatggcatccatgtcagcagtaaaaatcaggattcctcatctggcttagcttcctggataccaattttgcagctagatccagcagagtctccttctataagctgggtaaaccctcttggggtttatgatctgaagaccacactgtggctacaaggaaaaggcccccctgctgaacacagcttaccaaagaagcaagaacttcaagagaacccccagaatgtagactcccctctaatggcaaaggtggaagaatataacagcaaagtcagagagaatcccagggatgtcaaagcatggatggatttggtttcttttcaggatgaactcatgcgacatcccagttgttatgccatcagtgagggagaacaggaaatgagaaggaaatcatccaggctaatattagagaagaagctggctattttggaaagagcgattgaaagcaacccaaatgaagtggacctgaaactagcacggctgaagctttgcacagagttctgggagccatcagctgtggtgaaggaatggcagaaattgattttcttgcacccaaacaacccagccctgtggcagaaatatctcttattctgtcaaagtcagttcagcacctttactgtttccaaaacacatgtcctttatggaaaatgcctgagcacgttatcagctgtatatgatggcagtatggtatcacatcctgcactgccaggcacagaagaagccatgctagccatttttcttcagcaatgccatttccttaggcaggctggccattcagaaaaagctgtgtccctgttccaagccttgcttgactttaccttttttaaaccagataatgtcaaggatctgccaacaagaggacagggggagttctttgaacccttttgggacagcggagagcctcgaattggagaaaagggagctaaaggttggaaggcctggatgcatcaacaagagaagggtggctgggtggtcatcaatccacctgatgaagatgaggaagatgtagaggatgaagaagaaataaaggatagatctctaccaaagtggcaaaactggcttcatattgaacgttcccgggaagcaaggcactggttgccctggcggcctgaaaaaaacaagaaacagtcattagaagattgtgatgatccagagaggcaggtcttatttgatgaccttggaccatcattaataagactttccagtcctgaacttcagtttcaactactctcctcatttttgcaattcttaggagttccatgcagatatagacttttgccttctttcttctatatagcaatggataaaaacaacttctttgacaatgagtacaataaccaaggaactctgacttctttggacatgcctctttttggagttagtagtattggtcatatggactcaatggtccaaggtgagaagcatgtgactcatgctaaggaaggagaacaatttattcagaatctcttccatatgatgctgcccttgttttcaggcaaagacaagtctaacctatgcattttttggcttcagtatgaaatctctaaggtatctcagtatttgaaaatgggaaagaaaaagaaactaaaattgcaaggcaagaaaagcaaaaaattagccaaaaaccttcttaaggcacctgacaacagaaataatatttccctttggcaactgtatgcctacctggagtggttacttggcaatatagaagatgctagaaaggtttttgatacatctctggggatggctggaactactggaattcaaaacccccaattctgtcatcttagccttctttatgctaaactggaagcagaattgctagtaaatctagaaggagctgtggaatcacgtgcaacacacatattgaccaaattggctgaaagggggcattatgttccttatcatgggcaagtattatcagtgaatgttttgaaagctcggaaaacatacgagcacctgcttcaagattgtttaactgaaaactccacttctgatcaagaacatgctagtgattctagtcatctgattggtttggttggttgttacactcttttccagtatttaactcttgggattgactctgcagtgtcagtataccggcaggtttctcaaaagctgaaagaaaatcctgaaaaaaggtttagtggtcaacattttaccacgcctcttgaagccctctccctaatgcatgtcagcttgcttaggttccacatgaaaatgagtgtatatcctttgagtcctcttcgtgaagtactgttagaggttttaaagagatatcccagcaaccagtctctttggagggcgtacgtccagatccaaagcaagtctcacaatgcaagcaaagcccggcgtttttttgatggtgttacaagaactacaaaatcactggagccttggctgttcgcaatccaagcggagcaaataaagaaaaaactaattgaaagtgtccagagggagcccaatggagatgtgtatgcaaccattcctgaaattgggttaacaaatcgaatcaaagctttatttgaacatgcaattgagactgaaaacggtgctcattgtccattgctctggaggctgtatatatgcttcatggtgagaacatcatcatttgccttgcgttctctatctaatcccataggttactttaggagataaggcaaaaagtaaaggtgtattttacagagcgcttcaaaactgtccctgggcaaaagtgctatatatggatgcaatagaatactttccagatgagctgcaagagatccttgatctaattgctgagaaagaactgcgagtgcgggtaccaatagaaga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]