GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 10:26:24, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XR_002959113             193 bp    RNA     linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens uncharacterized LOC105374924
            (LOC105374924), transcript variant X3, ncRNA.
ACCESSION   XR_002959113
VERSION     XR_002959113.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018654713.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..193
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6p24.3-24.2"
     gene            1..193
                     /gene="LOC105374924"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 3 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:105374924"
     ncRNA           1..193
                     /ncRNA_class="lncRNA"
                     /gene="LOC105374924"
                     /product="uncharacterized LOC105374924, transcript variant
                     X3"
                     /db_xref="GeneID:105374924"
     variation       1
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1192368689"
     variation       4
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426523198"
     variation       8
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768131171"
     variation       9
                     /gene="LOC105374924"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1223527541"
     variation       10
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:942250047"
     variation       11
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:925709107"
     variation       16
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144503104"
     variation       20..24
                     /gene="LOC105374924"
                     /replace="aa"
                     /replace="aaa"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:528127669"
     variation       24..35
                     /gene="LOC105374924"
                     /replace="agag"
                     /replace="agagaaagagag"
                     /db_xref="dbSNP:367902414"
     variation       30..35
                     /gene="LOC105374924"
                     /replace="agag"
                     /replace="agagag"
                     /db_xref="dbSNP:1225798213"
     variation       31
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9460990"
     variation       32
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:931689642"
     variation       34
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1347818946"
     variation       35
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1284276593"
     variation       38
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919424570"
     variation       39..44
                     /gene="LOC105374924"
                     /replace="aga"
                     /replace="agaaga"
                     /db_xref="dbSNP:1364618736"
     variation       41..42
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:1561856156"
     variation       41
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:879867502"
     variation       42
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1050094335"
     variation       46
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771738928"
     variation       48
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:574043591"
     variation       57
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:946362305"
     variation       70
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:538385067"
     variation       72
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1043628786"
     variation       76
                     /gene="LOC105374924"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899714879"
     variation       78
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:996724585"
     variation       87..93
                     /gene="LOC105374924"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:1407985579"
     variation       93
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1029907299"
     variation       95
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1337099892"
     variation       101
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141204975"
     variation       102
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:577994195"
     variation       103
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1015655210"
     variation       107
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569239023"
     variation       108..109
                     /gene="LOC105374924"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:1561863740"
     variation       110
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760700387"
     variation       119
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:962720612"
     variation       120
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1363787075"
     variation       126
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1177292707"
     variation       128
                     /gene="LOC105374924"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:545014828"
     variation       132
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235793525"
     variation       133
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:556915365"
     variation       138
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1203382566"
     variation       152
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1023222903"
     variation       155
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276060891"
     variation       156
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1161085409"
     variation       159
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1027413422"
     variation       160
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761415455"
     variation       169
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951793402"
     variation       170
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:924108649"
     variation       175
                     /gene="LOC105374924"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1254737885"
     variation       178
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:907775032"
     variation       192
                     /gene="LOC105374924"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1472753202"
ORIGIN      
cagagctagactgcagaagaaaaagagaaagagaggggagaagaggtcaagtgtggaaacagcaagaaggctgctgtctgcaagccaagaagagagccctcgccagaaaccaaattatccagaccctggatattggatttccagcctccagaatgatacggctaagaccgcaggcatggtggcatgcagccgg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]