GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 14:33:40, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_002928116             366 bp    RNA     linear   PLN 19-MAR-2018
DEFINITION  PREDICTED: Rosa chinensis uncharacterized LOC112180120
            (LOC112180120), ncRNA.
ACCESSION   XR_002928116
VERSION     XR_002928116.1
DBLINK      BioProject: PRJNA438537
KEYWORDS    RefSeq.
SOURCE      Rosa chinensis
  ORGANISM  Rosa chinensis
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; fabids; Rosales; Rosaceae; Rosoideae;
            Rosoideae unplaced; Rosa.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_037094.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Rosa chinensis Annotation Release
                                           100
            Annotation Version          :: 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..366
                     /organism="Rosa chinensis"
                     /mol_type="transcribed RNA"
                     /cultivar="Old Blush"
                     /db_xref="taxon:74649"
                     /chromosome="7"
     gene            1..366
                     /gene="LOC112180120"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:112180120"
     ncRNA           1..366
                     /ncRNA_class="lncRNA"
                     /gene="LOC112180120"
                     /product="uncharacterized LOC112180120"
                     /db_xref="GeneID:112180120"
ORIGIN      
ctcaagaagagattgatgtagttcgaatagaatgggcagagcaggttgatggatatattgaagatgaagtaaaatagtcagcatagattgcaagcatgttgatatcactgtaggaaaaatttagaaagtaaagttccagatattgcaaaatatggatttacatcggcatggttgccgccatcaactcattcctttgccccggaaggttacctccttcagaacatatattccctcaattctaaatatggatctcagcgccaattaagaggtttactaaaaaaaattgggttacctccctcagaacatatattccattgaattgggtttatttatttacagcttactctattttttgtttcctaatat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]