2024-04-20 13:02:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002911136 130 bp RNA linear PRI 11-APR-2023 DEFINITION PREDICTED: Pongo abelii small nucleolar RNA SNORA31 (LOC112128646), ncRNA. ACCESSION XR_002911136 VERSION XR_002911136.1 DBLINK BioProject: PRJNA944618 KEYWORDS RefSeq. SOURCE Pongo abelii (Sumatran orangutan) ORGANISM Pongo abelii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Pongo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_071998) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_028885655.1-RS_2023_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..130 /organism="Pongo abelii" /mol_type="transcribed RNA" /isolate="AG06213" /db_xref="taxon:9601" /chromosome="13" /sex="male" /tissue_type="fibroblast" gene 1..130 /gene="LOC112128646" /note="small nucleolar RNA SNORA31; Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:112128646" ncRNA 1..130 /ncRNA_class="snoRNA" /gene="LOC112128646" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:14.6:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.4" /db_xref="GeneID:112128646" /db_xref="RFAM:RF00322" ORIGIN
ctgcatccactgatagaccttgaacaatttactgttgttcttttggtttgcactaggatgcaaaagaaagaaatccctgcgctttctgtctgtctttgtggcggcccagattgaattggggaatacatct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]