2024-04-27 03:23:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002892663 128 bp RNA linear MAM 14-APR-2023 DEFINITION PREDICTED: Physeter catodon small nucleolar RNA SNORA31 (LOC112066446), ncRNA. ACCESSION XR_002892663 VERSION XR_002892663.1 DBLINK BioProject: PRJNA434122 KEYWORDS RefSeq. SOURCE Physeter catodon (sperm whale) ORGANISM Physeter catodon Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha; Cetacea; Odontoceti; Physeteridae; Physeter. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_041234.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_002837175.3-RS_2023_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/05/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..128 /organism="Physeter catodon" /mol_type="transcribed RNA" /isolate="SW-GA" /db_xref="taxon:9755" /chromosome="21" /sex="female" /tissue_type="muscle" /dev_stage="adult" gene 1..128 /gene="LOC112066446" /note="small nucleolar RNA SNORA31; Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:112066446" ncRNA 1..128 /ncRNA_class="snoRNA" /gene="LOC112066446" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:14.6:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.4" /db_xref="GeneID:112066446" /db_xref="RFAM:RF00322" ORIGIN
ctgcgtccactgatagaccttgaacaatctgctgttgttcttttggtttgcactaagatgcaaaagaaaaatccctgcgctttctgtctgtctttgtggcagcccagattgaataggggaatacattt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]