GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 08:45:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_002892044             128 bp    RNA     linear   MAM 14-APR-2023
DEFINITION  PREDICTED: Physeter catodon small nucleolar RNA SNORA31
            (LOC112065444), ncRNA.
ACCESSION   XR_002892044
VERSION     XR_002892044.1
DBLINK      BioProject: PRJNA434122
KEYWORDS    RefSeq.
SOURCE      Physeter catodon (sperm whale)
  ORGANISM  Physeter catodon
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Artiodactyla; Whippomorpha;
            Cetacea; Odontoceti; Physeteridae; Physeter.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_041226.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_002837175.3-RS_2023_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/05/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..128
                     /organism="Physeter catodon"
                     /mol_type="transcribed RNA"
                     /isolate="SW-GA"
                     /db_xref="taxon:9755"
                     /chromosome="13"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
     gene            1..128
                     /gene="LOC112065444"
                     /note="small nucleolar RNA SNORA31; Derived by automated
                     computational analysis using gene prediction method:
                     cmsearch."
                     /db_xref="GeneID:112065444"
     ncRNA           1..128
                     /ncRNA_class="snoRNA"
                     /gene="LOC112065444"
                     /product="small nucleolar RNA SNORA31"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:14.6:RF00322"
                     /inference="COORDINATES: profile:INFERNAL:1.1.4"
                     /db_xref="GeneID:112065444"
                     /db_xref="RFAM:RF00322"
ORIGIN      
ctgcatccactgatagaccttgaacaatctgctgttgttcttttggtttgcactaggatgcaaaagaaaaatccctgcgctttctgtctgtctgtgtggcagcccagattgaataggggaatacattt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]