2024-04-27 02:26:16, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002826045 127 bp RNA linear MAM 26-JAN-2018 DEFINITION PREDICTED: Myotis lucifugus small nucleolar RNA SNORA31 (LOC111823056), ncRNA. ACCESSION XR_002826045 VERSION XR_002826045.1 DBLINK BioProject: PRJNA208947 KEYWORDS RefSeq. SOURCE Myotis lucifugus (little brown bat) ORGANISM Myotis lucifugus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera; Vespertilionidae; Myotis. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_005871052.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Myotis lucifugus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..127 /organism="Myotis lucifugus" /mol_type="transcribed RNA" /db_xref="taxon:59463" /chromosome="Unknown" /sex="female" /country="USA: Framingham, MA" gene 1..127 /gene="LOC111823056" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:111823056" ncRNA 1..127 /ncRNA_class="snoRNA" /gene="LOC111823056" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111823056" /db_xref="RFAM:RF00322" ORIGIN
ctgcatccactgatagaccttgaacaacctgttgttcttttggtttgcactgggatgcgaaagaaaaatatccctgcgctttctgtctgtctttgtggcggcccagattgaataagggactacatct
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]