2024-04-26 07:18:53, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002820447 133 bp RNA linear ROD 24-JAN-2018 DEFINITION PREDICTED: Octodon degus small nucleolar RNA SNORA64/SNORA10 family (LOC111815813), ncRNA. ACCESSION XR_002820447 VERSION XR_002820447.1 DBLINK BioProject: PRJNA193441 KEYWORDS RefSeq. SOURCE Octodon degus (degu) ORGANISM Octodon degus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Hystricomorpha; Octodontidae; Octodon. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_004524597.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Octodon degus Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..133 /organism="Octodon degus" /mol_type="transcribed RNA" /isolate="3935" /db_xref="taxon:10160" /chromosome="Unknown" /sex="female" gene 1..133 /gene="LOC111815813" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:111815813" ncRNA 1..133 /ncRNA_class="snoRNA" /gene="LOC111815813" /product="small nucleolar RNA SNORA64/SNORA10 family" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00264" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111815813" /db_xref="RFAM:RF00264" ORIGIN
actctctccactctgcacagttacactagttgtggtgtgactttcgtacaggagagagaaagaaaagagctcttcaaaaggaccttgaactggcctcatggtggccattctttctttgaggggcactacagat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]