2024-04-23 19:19:49, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002793347 123 bp RNA linear MAM 21-JUL-2023 DEFINITION PREDICTED: Dasypus novemcinctus small nucleolar RNA SNORA31 (LOC111759323), ncRNA. ACCESSION XR_002793347 VERSION XR_002793347.1 DBLINK BioProject: PRJNA994966 KEYWORDS RefSeq. SOURCE Dasypus novemcinctus (nine-banded armadillo) ORGANISM Dasypus novemcinctus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Xenarthra; Cingulata; Dasypodidae; Dasypus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_080699) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_030445035.1-RS_2023_07 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 07/18/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..123 /organism="Dasypus novemcinctus" /mol_type="transcribed RNA" /isolate="mDasNov1" /db_xref="taxon:9361" /chromosome="27" /sex="male" /tissue_type="muscle" /dev_stage="adult" /country="USA: Central Arkansas" /lat_lon="35.0781 N 92.4579 W" /collection_date="2020-03-20" /collected_by="Jeff Padberg" gene 1..123 /gene="LOC111759323" /note="small nucleolar RNA SNORA31; Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:111759323" ncRNA 1..123 /ncRNA_class="snoRNA" /gene="LOC111759323" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:14.6:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.4" /db_xref="GeneID:111759323" /db_xref="RFAM:RF00322" ORIGIN
ctgcatctactgatagaccttgaacaaattgttgttcttttggtttgcactaggatgcagaagaaaaaactccctgcactttctgcctttgtggcagcccagattgaataggggaatatatat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]