LOCUS       XR_002792089             152 bp    RNA     linear   ROD 19-JAN-2018
DEFINITION  PREDICTED: Cavia porcellus uncharacterized LOC106028467
            (LOC106028467), transcript variant X4, ncRNA.
ACCESSION   XR_002792089
VERSION     XR_002792089.1
DBLINK      BioProject: PRJNA73553
KEYWORDS    RefSeq.
SOURCE      Cavia porcellus (domestic guinea pig)
  ORGANISM  Cavia porcellus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Hystricomorpha; Caviidae; Cavia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NT_176250.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cavia porcellus Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..152
                     /organism="Cavia porcellus"
                     /mol_type="transcribed RNA"
                     /strain="inbred line 2N"
                     /specimen_voucher="Broad Sequencing.Sample 289.1, Broad
                     Institute, Cambridge, MA"
                     /db_xref="taxon:10141"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..152
                     /gene="LOC106028467"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 12 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:106028467"
     ncRNA           1..152
                     /ncRNA_class="lncRNA"
                     /gene="LOC106028467"
                     /product="uncharacterized LOC106028467, transcript variant
                     X4"
                     /db_xref="GeneID:106028467"
ORIGIN      

cgcgtctatctaagcgcccttccgctgggctaccgcctgccccgagctccctgcgtgcaccgcgcgccgctcggtgcggtagcggggattgctttcaggacctcatgcatactagagtcttactatgcagttcaggctgaccttgaactcac

//