2024-04-27 00:36:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002789411 106 bp RNA linear ROD 19-JAN-2018 DEFINITION PREDICTED: Cavia porcellus small nucleolar RNA SNORA31 (LOC111754743), ncRNA. ACCESSION XR_002789411 VERSION XR_002789411.1 DBLINK BioProject: PRJNA73553 KEYWORDS RefSeq. SOURCE Cavia porcellus (domestic guinea pig) ORGANISM Cavia porcellus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Hystricomorpha; Caviidae; Cavia. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NT_176286.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Cavia porcellus Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..106 /organism="Cavia porcellus" /mol_type="transcribed RNA" /strain="inbred line 2N" /specimen_voucher="Broad Sequencing.Sample 289.1, Broad Institute, Cambridge, MA" /db_xref="taxon:10141" /chromosome="Unknown" /sex="female" gene 1..106 /gene="LOC111754743" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:111754743" ncRNA 1..106 /ncRNA_class="snoRNA" /gene="LOC111754743" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111754743" /db_xref="RFAM:RF00322" ORIGIN
ctgcatccactgatagaccttgaacaatttgttgttcttatggtttgcactaggatgataaaggaaaaatccctgcacataattctgcataattagtggtatgttt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]