GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-27 03:57:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_002788669             126 bp    RNA     linear   ROD 19-JAN-2018
DEFINITION  PREDICTED: Cavia porcellus small nucleolar RNA SNORA31
            (LOC111753901), ncRNA.
ACCESSION   XR_002788669
VERSION     XR_002788669.1
DBLINK      BioProject: PRJNA73553
KEYWORDS    RefSeq.
SOURCE      Cavia porcellus (domestic guinea pig)
  ORGANISM  Cavia porcellus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Hystricomorpha; Caviidae; Cavia.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NT_176414.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Cavia porcellus Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..126
                     /organism="Cavia porcellus"
                     /mol_type="transcribed RNA"
                     /strain="inbred line 2N"
                     /specimen_voucher="Broad Sequencing.Sample 289.1, Broad
                     Institute, Cambridge, MA"
                     /db_xref="taxon:10141"
                     /chromosome="Unknown"
                     /sex="female"
     gene            1..126
                     /gene="LOC111753901"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:111753901"
     ncRNA           1..126
                     /ncRNA_class="snoRNA"
                     /gene="LOC111753901"
                     /product="small nucleolar RNA SNORA31"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00322"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:111753901"
                     /db_xref="RFAM:RF00322"
ORIGIN      
ctgcatccactgatagaccttgaacaatttgttgttcttatggtttgcactaggatgctaaaggaaaaatccctgcactttctgtctgtctttatggcagcccagattgaattggggagtacacct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]