GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 07:43:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_002779352             128 bp    RNA     linear   MAM 19-JAN-2018
DEFINITION  PREDICTED: Pteropus vampyrus small nucleolar RNA SNORA31
            (LOC111737098), ncRNA.
ACCESSION   XR_002779352
VERSION     XR_002779352.1
DBLINK      BioProject: PRJNA275879
KEYWORDS    RefSeq.
SOURCE      Pteropus vampyrus (large flying fox)
  ORGANISM  Pteropus vampyrus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Megachiroptera;
            Pteropodidae; Pteropodinae; Pteropus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_011888782.1) annotated using gene prediction method: cmsearch.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Pteropus vampyrus Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..128
                     /organism="Pteropus vampyrus"
                     /mol_type="transcribed RNA"
                     /isolate="Shadow"
                     /isolation_source="Lubee Bat Conservancy"
                     /db_xref="taxon:132908"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="Kidney"
     gene            1..128
                     /gene="LOC111737098"
                     /note="Derived by automated computational analysis using
                     gene prediction method: cmsearch."
                     /db_xref="GeneID:111737098"
     ncRNA           1..128
                     /ncRNA_class="snoRNA"
                     /gene="LOC111737098"
                     /product="small nucleolar RNA SNORA31"
                     /inference="COORDINATES: nucleotide
                     motif:Rfam:12.0:RF00322"
                     /inference="COORDINATES: profile:INFERNAL:1.1.1"
                     /db_xref="GeneID:111737098"
                     /db_xref="RFAM:RF00322"
ORIGIN      
catcaaccacggatagaccttgaacaaattgctattgttcgtttggattgtattagaatgagaaaggaaaaaaaatctctgtgctttctgtctttgtggcggcccagattgaatactgaaatacatct
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]