2024-03-29 17:59:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002770022 129 bp RNA linear MAM 31-DEC-2019 DEFINITION PREDICTED: Sarcophilus harrisii small nucleolar RNA SNORA31 (LOC111720273), ncRNA. ACCESSION XR_002770022 VERSION XR_002770022.1 DBLINK BioProject: PRJNA596784 KEYWORDS RefSeq. SOURCE Sarcophilus harrisii (Tasmanian devil) ORGANISM Sarcophilus harrisii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Metatheria; Dasyuromorphia; Dasyuridae; Sarcophilus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_045428.1) annotated using gene prediction method: cmsearch. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Sarcophilus harrisii Annotation Release 103 Annotation Version :: 103 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..129 /organism="Sarcophilus harrisii" /mol_type="transcribed RNA" /db_xref="taxon:9305" /chromosome="3" /cell_line="91H" gene 1..129 /gene="LOC111720273" /note="Derived by automated computational analysis using gene prediction method: cmsearch." /db_xref="GeneID:111720273" ncRNA 1..129 /ncRNA_class="snoRNA" /gene="LOC111720273" /product="small nucleolar RNA SNORA31" /inference="COORDINATES: nucleotide motif:Rfam:12.0:RF00322" /inference="COORDINATES: profile:INFERNAL:1.1.1" /db_xref="GeneID:111720273" /db_xref="RFAM:RF00322" ORIGIN
ctgcatccactgatagaccttgaacaagttactgttgttcactggtttgcactagggtgccaaagagaagtcctcgcgctttctgtctgtctctctgtggcagcccagattgaatagaggaatacattt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]