2025-10-16 07:03:49, GGRNA.v2 : RefSeq release 232 (Sep, 2025)
LOCUS XR_002611008 365 bp RNA linear INV 31-AUG-2017 DEFINITION PREDICTED: Limulus polyphemus uncharacterized LOC111086280 (LOC111086280), ncRNA. ACCESSION XR_002611008 VERSION XR_002611008.1 DBLINK BioProject: PRJNA238073 KEYWORDS RefSeq. SOURCE Limulus polyphemus (Atlantic horseshoe crab) ORGANISM Limulus polyphemus Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Chelicerata; Merostomata; Xiphosura; Limulidae; Limulus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_013666596.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Limulus polyphemus Annotation Release 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..365 /organism="Limulus polyphemus" /mol_type="transcribed RNA" /db_xref="taxon:6850" /chromosome="Unknown" /sex="male" /tissue_type="muscle" /geo_loc_name="USA: Woods Hole, MA" /collection_date="Jan-2008" gene 1..365 /gene="LOC111086280" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:111086280" ncRNA 1..365 /ncRNA_class="lncRNA" /gene="LOC111086280" /product="uncharacterized LOC111086280" /db_xref="GeneID:111086280" ORIGIN
gtggaatgaaatcagatttgaatttaaccacctgagcaaactactactttgaatgataagaatgaaccatcactactggaaacgttataccgaagcaaggatactctggaaaccatatttaggtttatcgatagagatgggtcaggtcttatctccatggaagaatttacagatgcatgccatctactaagtcaacacttagggacagctatgtcacaagaagagattgatgatttggccaagagtatagacattaacaaagacggatttattgatttcaatgagtttttggaagccttccgtcttgtagacaaggagccctcccctgtattacaggcaagagagtaaacattgttcttgtggta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]