LOCUS       XR_002591448             219 bp    RNA     linear   PLN 01-SEP-2020
DEFINITION  PREDICTED: Helianthus annuus uncharacterized LOC110938512
            (LOC110938512), ncRNA.
ACCESSION   XR_002591448
VERSION     XR_002591448.2
DBLINK      BioProject: PRJNA396063
KEYWORDS    RefSeq.
SOURCE      Helianthus annuus (common sunflower)
  ORGANISM  Helianthus annuus
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; asterids; campanulids; Asterales; Asteraceae;
            Asteroideae; Heliantheae alliance; Heliantheae; Helianthus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_035440.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 1, 2020 this sequence version replaced XR_002591448.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Helianthus annuus Annotation Release
                                           101
            Annotation Version          :: 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..219
                     /organism="Helianthus annuus"
                     /mol_type="transcribed RNA"
                     /cultivar="XRQ/B"
                     /specimen_voucher="SF193"
                     /db_xref="taxon:4232"
                     /chromosome="8"
                     /tissue_type="leaves"
                     /dev_stage="4 leaves"
                     /geo_loc_name="France"
                     /collected_by="INRA, LIPM"
     gene            1..219
                     /gene="LOC110938512"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 4 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:110938512"
     ncRNA           1..219
                     /ncRNA_class="lncRNA"
                     /gene="LOC110938512"
                     /product="uncharacterized LOC110938512"
                     /db_xref="GeneID:110938512"
ORIGIN      

ctcaagtacggcgtgcaacaagtgcctacccacgtcgtcaaagaactcatcatgcacgaggtggtgcttgggggtggccaggatgcatctgctgttaccacaaccatcatcgtgcggggaagtttgaagccaaattttatgacaaggttctgcaagaagagattggaggcgttaaaggacatttcgggccaattaatgctttggcattcaacccggatg

//