LOCUS       XR_002447259             240 bp    RNA     linear   PLN 13-JUN-2017
DEFINITION  PREDICTED: Sorghum bicolor uncharacterized LOC110430061
            (LOC110430061), ncRNA.
ACCESSION   XR_002447259
VERSION     XR_002447259.1
DBLINK      BioProject: PRJNA38691
KEYWORDS    RefSeq.
SOURCE      Sorghum bicolor (sorghum)
  ORGANISM  Sorghum bicolor
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD
            clade; Panicoideae; Andropogonodae; Andropogoneae; Sorghinae;
            Sorghum.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_012878.2) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Sorghum bicolor Annotation Release
                                           101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..240
                     /organism="Sorghum bicolor"
                     /mol_type="transcribed RNA"
                     /cultivar="BTx623"
                     /db_xref="taxon:4558"
                     /chromosome="9"
     gene            1..240
                     /gene="LOC110430061"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:110430061"
     ncRNA           1..240
                     /ncRNA_class="lncRNA"
                     /gene="LOC110430061"
                     /product="uncharacterized LOC110430061"
                     /db_xref="GeneID:110430061"
ORIGIN      

gacagcatggcatcccgcgccggaggcagctcgacgtcccaacggcgcaggccgttcgtgtgctcaccctcctatccaacaagaagtgggaccttgaactccatacacaggatcaatagctacctggcttttggcgtttgattccaagaagtcgggaaaggaatacaaaacatggcatgctcttgtaaggacttttgttagatgattttgctgcatttctacgatattaggaaaggaaaa

//