GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-25 08:19:35, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_002417848            3949 bp    RNA     linear   VRT 24-MAY-2017
DEFINITION  PREDICTED: Columba livia NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X2, misc_RNA.
ACCESSION   XR_002417848
VERSION     XR_002417848.1
DBLINK      BioProject: PRJNA217047
KEYWORDS    RefSeq.
SOURCE      Columba livia (rock pigeon)
  ORGANISM  Columba livia
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Columbiformes; Columbidae;
            Columba.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004973385.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Columba livia Annotation Release 102
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3949
                     /organism="Columba livia"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:8932"
                     /chromosome="Unknown"
                     /sex="male"
                     /tissue_type="blood"
                     /country="Denmark: Vordingborg"
                     /collection_date="13-Jun-2010"
                     /breed="Danish Tumbler"
                     /note="bred by Anders Christiansen, Hans Ove Christiansen,
                     and certified by Danmarks Racedueforeninger"
     gene            1..3949
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 6 ESTs, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     3 samples with support for all annotated introns"
                     /db_xref="GeneID:102089446"
     misc_RNA        1..3949
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X2"
                     /db_xref="GeneID:102089446"
ORIGIN      
tggccttgttgaacttcatgaaggtcacacaggcctacctctcaagcctgttaaggtccctctggatggtatcgcttccctccagcatgctaactgcaccacacagctaggtgttgttgggggagtgcactccatcccactgttcatggccccaacagagaagttaagcagcactgatcccagtactgagctctgaggaaccccactcatcactggtcttcacttgtagattgagctgttgaccacaactctttaagtgtgaccatccagcccattccttatcaaccaagtggtccatcagtcaaatccatgtctctccaatttagagatgagggtgttatgcgggacagtgtcaaatgctttgcgcaagtccacgtagattatgtcattggctcttgccttatctactaacgctgtaactgcgttgcagaaattcgtcaggcacgatttgctcttagtgaagccatggtgactcttgccaatcaccttatttttcatgtatttttcttgatgagtttaactcaggttaacagactgttttgcagcctgctctatttttaatccttttgtggacaacagttcagcgatatgagatggaagaaagagttttggtatgaagagctatttctgaaagaaatactttagaaggagaagagatatatggcttggcagacaatgagttcatgctatttaaggattagagaattggactggcttagtaacccaagcttctctgcggaagatgcactgttactgcatcagcgcactacggaagttgcaaatctcatccctgagaaaccaccactaataaggactccttcaagatcagagttgtcaggggaaagtgatacagatgagagtctgaaacgggcaagtaagaaaagaaaaaagcaaaagaaaaagcatcaccactacaagaagacaaaaaagaaaaccaaaggggactccagtagcagtgagtcggacctggacactaagcacatcaaggacaaagctgcacgaagctccagaaatcacgaaaaggaagcagcagcaaacctagataagaaaacatcaaatcttaccagcaatcgctttgtttggcttgatgatgtccaggctttcacagcagaaaccttcaggatagacaagaaaccagaccctgcaaactgggcctacaaatccttgtatcgaggagacatagcaaggtataaaaggagaggagagtcctgtcttggcatagatgcaaagaaacagtgtataacttgggagagttctgcatcaaaaaagaagcaattgcagaggcaccctgagcgctacttcacaaaaaacaatgtgaagatactgaacacagatgggattcctgtttgcaagaaaagttcttcatctgaccccactgcttttataccagtttttgaaacggaaactgatgatccttctggcacagtggaggtaaattctcttgggatatatgatccgtcagctacagtgcagctacaagaaaaagggtgcagggctgcagaccatgatcctgtaaatacacagcaaacaattcaagagcctgggataaatatcaactccaccctaatgacgaaagtggaagaacataacaggaaagtcagagaaaacccaagagatattaatgcttggatggaatttgtttcttttcaggatgaattaatgagaggatctaacctttatgccagcaagggagagcaggaagtaagaagaaaatcactgaagttaatcttggaaaagaaactggctattttagagagggcaattgaaagcaatccaagtaatgttgatctgaaacttgccaggctgaagatttgcactgaattctgggaaccaccagctttgatcaaagaatggcagaagctaattttcttacatcccaataatccagagctgtggaagaaatatctcctgttctgtcaaagtcagttcactacgttttctgtttcaaaaatcaatagtctctacggaaaatgcttgacgacattggcagctgtacaagatggcagcatggtatcgcatcctctgctgcctgggacagaagaagctatgctagctatatttattcagcagtgccacttcctgagacaggctggccattctgagaaagcagtgtctttgtttcaggctctgattgacttcaccttctttaaacctgacagtgtaaaagatctgccaacaaggggacaggttgaattctttgaacccttttgggatagtggagaaccacgaattggagagaaaggagcaagaggctggaaagcgtggatgcaccaacaagaaaagggtggctggattgctgttaagcctgatgatgatgatgatgaagagatagacgaggatcaagaaataaaggataaaactctccccaagtggcacatttggctggatattgaatattctcgtgaagcaaggcattggttaccttggaggccagacaaaaccaaaaaggaaaccgaagaagattgtgaagatccagaaagacaggtattatttgatgatcttggaccatctttaatccgtctttctaatccagatcttcaacgacaactactgtactcatttttgcaattcctgggagttccatgcacaagtaaactctttccttccaacctctatattgccatggatgaaaataacatttttgacagtgtgctttctgatgaaaagccactgacttttgttgattttccgctttctggattcaacagtattggtcatatggacacgatgctacgagagagacatcacataggccactgtaaagaaggagaggagttcatacacaatgttttccatgttctatccctgctgtttacaggaaaggaaaagtgcaacctgtccatttgttggttacagtatgaaatatcgaaggtcattcagtgtctccaaacaaaaaaaaagaagaagctgaaaatacaagggaggaagagtaaaaaattggccaagaatctccttaaagcaccggacaaccgaaatgacctttctctctggaaactatacgcctacttagagtggctgcttggtaacactgatgacgccaggaaggtgcttgacacggctctttgcacagcagggacaggagggttgaagagttcccagctctgcggcctcggtctgctttatgctcagctggaagtggaactactagaaagtctagaaggagctgttatgtcacgtgctgttcatgtgttgaccaaattggctgaaagtggactatatgtaccctatagtggacaagtgttacctgtgaatgtcttgaaagctcgtaaaacatatgagcatgcactgcaagattatttaggtaaaacaccggtttctgatcaggatcgggtcagtgatactaatcagctggttaacttggttggttgttacgcactgttacagtatttgactgttgggattgatgctgcagtattaatatatgcacagacttcagaaaaacttgaagctcttggtccacagaaatgtgaaaatactggagagaattttggcattcaaaattttcccactgctctggaagctgtcacactgctgcatacaaatttactcagattccacatgaaaattagcgtttatcctttgaatcctttgcgagaggcactaacggaggctctgaaacggtatcctagcaaccagtctctttggaggtcatatatccacatccaaagaaagtctcacagtgctagcaaagcacgaagattttttgatggtgtcacaaggtctactgattctttagagccatggctgtttgcaatccaagcagagcagatgagaaaaagactcattgagaatgtccagaggtgctggtgaaatacattccactattcctgaaactgggttaacaaatcggattatagctctgtttgaacatgcagttcagagtgaaaatggtgcccattgtccgctgctgtggagaatgtatttgaactttctggcttcagtaggaaac
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]