GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-17 11:25:02, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_002330339            1078 bp    RNA     linear   PLN 11-MAY-2017
DEFINITION  PREDICTED: Arabidopsis lyrata subsp. lyrata uncharacterized
            LOC9306824 (LOC9306824), transcript variant X1, ncRNA.
ACCESSION   XR_002330339
VERSION     XR_002330339.1
DBLINK      BioProject: PRJNA49545
KEYWORDS    RefSeq.
SOURCE      Arabidopsis lyrata subsp. lyrata
  ORGANISM  Arabidopsis lyrata subsp. lyrata
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Camelineae; Arabidopsis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_003302549.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Arabidopsis lyrata subsp. lyrata
                                           Annotation Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1078
                     /organism="Arabidopsis lyrata subsp. lyrata"
                     /mol_type="transcribed RNA"
                     /sub_species="lyrata"
                     /bio_material="NASC:donor number MN47"
                     /db_xref="taxon:81972"
                     /chromosome="Unknown"
     gene            1..1078
                     /gene="LOC9306824"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 1 EST, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     47 samples with support for all annotated introns"
                     /db_xref="GeneID:9306824"
     ncRNA           1..1078
                     /ncRNA_class="lncRNA"
                     /gene="LOC9306824"
                     /product="uncharacterized LOC9306824, transcript variant
                     X1"
                     /db_xref="GeneID:9306824"
ORIGIN      
tctattcctatgatcaatcttattgtgagcatgttctttctcttctgctgatctttgttaaaactgtttcgatccaatcaatcgtatttttatttattttcatgacagttgattataaactattttctcgatcatcggatctttggtctgagatttttatattgctcgatggattgttgattagatctgagttaacttgttgtatgtgatcttaatagttgatttgtgatgtgattgggtaattctggagcagcataacaaatccatagttttcttcttcttgatacataagatggaagctacagatgttaaggctaggtgtattcattgttctggattgactagttgtaagactaaagatggtgtcacaactagtgcaatgggaaaacacatgagaatatgcaaaatgatgcctcgggaactacctgatgatacgttaatatcataaaaggcatccttctggacgtcttgttgatgctaatgaagactacgaagcacgcctgaaggaggaaccagttattgcgttcagtggagaggaaggcaatggtcggtacttggacttgcatgagtacatcaactctaaatttggggaaagggttgaataccgcgataaactgaagttatcgaggcaatacaggaagtatatggaagctctgctagagtacttggtctactttttccagcgaaccgagccgttgcaagatcttgaccggatactttctagccgttgcaagatcttgaccggatactttctagccgttgcaagatcttgaccggatactttctaaggcaatacaggaagtatatggaagctctgctagagtacttggtctactttttccagcgaaccgagccgttgcaagatcttgaccggatactttctaaggtttaagatcctccctttctttatcgttttattgtgttcaccttgtaccttatggattcttatgggcgttttgatctatgcattagtacagaactggtatgttattcgtgcttaagaattttctactagtttcccaagtagaactttgaattttcttagttttaacaactggttgctttgtgagtgttctaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]