2024-04-25 07:49:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_002271587 395 bp RNA linear PLN 21-MAR-2017 DEFINITION PREDICTED: Prunus persica uncharacterized LOC109949103 (LOC109949103), ncRNA. ACCESSION XR_002271587 VERSION XR_002271587.1 DBLINK BioProject: PRJNA241430 KEYWORDS RefSeq. SOURCE Prunus persica (peach) ORGANISM Prunus persica Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Rosales; Rosaceae; Amygdaloideae; Amygdaleae; Prunus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_034009.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Prunus persica Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.3 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..395 /organism="Prunus persica" /mol_type="transcribed RNA" /cultivar="Lovell" /db_xref="taxon:3760" /chromosome="G1" gene 1..395 /gene="LOC109949103" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 11 samples with support for all annotated introns" /db_xref="GeneID:109949103" ncRNA 1..395 /ncRNA_class="lncRNA" /gene="LOC109949103" /product="uncharacterized LOC109949103" /db_xref="GeneID:109949103" ORIGIN
tgtgatgttgtggtgtttacgggggtgggggtattaggctttggattagtattcaaattctcggcgctatagacaattgcatgatagtgttttgtacttgatttgtgcaagttatggaagctcaaaaaaggggatcaacaaaaggaaagcgcaaagtcgacagtaatgtgcaacaatcaagagttggccgagatgcattttttaatttcatgtacaagaagagattgctaataaatggaggaaattaaaccttaaagagaaggctacatatggttctgccttggaaggttcgagtgggccaaggattaaaatatcaaccatgtaaataatatagggcctccaatttacggatatttcgggggatatattattatcgtcttaggtatcggaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]