LOCUS       XR_002140896             394 bp    RNA     linear   INV 28-DEC-2016
DEFINITION  PREDICTED: Branchiostoma belcheri uncharacterized LOC109481402
            (LOC109481402), ncRNA.
ACCESSION   XR_002140896
VERSION     XR_002140896.1
DBLINK      BioProject: PRJNA358734
KEYWORDS    RefSeq.
SOURCE      Branchiostoma belcheri (Belcher's lancelet)
  ORGANISM  Branchiostoma belcheri
            Eukaryota; Metazoa; Chordata; Cephalochordata; Leptocardii;
            Amphioxiformes; Branchiostomatidae; Branchiostoma.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017804187.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Branchiostoma belcheri Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..394
                     /organism="Branchiostoma belcheri"
                     /mol_type="transcribed RNA"
                     /isolate="BF01"
                     /isolation_source="seawater"
                     /db_xref="taxon:7741"
                     /chromosome="Unknown"
                     /sex="male"
                     /cell_type="sperm cells"
                     /tissue_type="gonad"
                     /dev_stage="adult"
                     /country="China: Xiamen Bay"
                     /collection_date="Aug-2008"
                     /breed="outbred"
     gene            1..394
                     /gene="LOC109481402"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:109481402"
     ncRNA           1..394
                     /ncRNA_class="lncRNA"
                     /gene="LOC109481402"
                     /product="uncharacterized LOC109481402"
                     /db_xref="GeneID:109481402"
ORIGIN      

agaaccgagattcgaatgcagacgaccggacgcgatgaaatttaggggtgaccttgaacagtttgtgatcatggcacaagaacatggaggcgccatcattctgtcacgtttcctttcgtcacacaagcaagtttagaggtgaccttgaacagttcacaagaacctgaagggcgccttgattcatggattcatgcacgctttcgttcatcacaagcaatgaagtttagaagtgatcacaagaaacatggaggatggagggcgccatcactaagtcattttttttcaccaccgaagagcaatgaagtttagaggtgaccttgaagtcaaaaacacaacaaccaagaagggcatcatcactcgctccagtttgcacgtggacacaagcacagtgagg

//