GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2019-03-23 03:30:40, GGRNA.v2 : RefSeq release 92 (Jan, 2019)

LOCUS       XR_002083621            4985 bp    RNA     linear   MAM 05-DEC-2016
DEFINITION  PREDICTED: Panthera pardus NRDE-2, necessary for RNA interference,
            domain containing (NRDE2), transcript variant X1, misc_RNA.
ACCESSION   XR_002083621
VERSION     XR_002083621.1
DBLINK      BioProject: PRJNA355165
KEYWORDS    RefSeq.
SOURCE      Panthera pardus (leopard)
  ORGANISM  Panthera pardus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Carnivora; Feliformia; Felidae;
            Pantherinae; Panthera.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_017619883.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Panthera pardus Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.2
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4985
                     /organism="Panthera pardus"
                     /mol_type="transcribed RNA"
                     /isolate="Maewha"
                     /db_xref="taxon:9691"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
     gene            1..4985
                     /gene="NRDE2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 3 Proteins, and 100% coverage of
                     the annotated genomic feature by RNAseq alignments,
                     including 36 samples with support for all annotated
                     introns"
                     /db_xref="GeneID:109274446"
     misc_RNA        1..4985
                     /gene="NRDE2"
                     /product="NRDE-2, necessary for RNA interference, domain
                     containing, transcript variant X1"
                     /db_xref="GeneID:109274446"
ORIGIN      
gtccccgggtcaagccccagggagtgcgagtgggaaaaaccacacttcccagagtgcaccgcaaccgcgaaggcctcactaccggcgtccgctcgccggcgccatttctggagaggggaacggcggtgcggcctgcagtcatggcgctgttcccggcctttgcaggcattggtgagacttccggtagcggcagcgccaggaaagaattagactggctgagcaacccaagcttttgtgctggagccataacctctctgagccaacaaactgaaggggccacagccctggtttctgaagggtcacctctgacaaggagccctctgaaatcagagccttcggatgaaagtgacactaacaaaaagcccaaacaaacaagcagaaaaaagaagaaagagaaaaagaagaaaaggaagcatcaccacaagaaaactaggagaaaacacggccagtccagtagcagtgggtctgagccagatagtgattctgaaaaggataaaacttccagaagcattagagacagtaaaaaggaatccgagaaaccaaaccgagaagggaacgccgtcgctgatactgggcaccgctgcatctggcttgaggacgttcaggctctcacaggggaaaccttcagaacagataagaaaccagatcctgcaaactgggagtacaagtctctctaccgaggagatatagcaagatacaagaggaaaggagactcctgccttggcattaaccctaagaagcagtgcatatcctgggagggggctgccacagaaaagaagcactcacacaagcatgtcgagcgctatttcacaaagaagagcgtgggactgatgaacattgacggagtcgccgttggcggtaaaaccgaacctccctcatctgagccggtctcatttatcccagtgaaggcctcggatgatatggctcctcctgttacgacctggttgaaccctctggggatttatgatcagtccaccacgcagtggttacaaggacagggtccttcagagcaagaatcaaagcagccagactcacagacagacagagagcatgccctgctcaaggccaaggtggaggagtttaacaggagagttcgggagaatccccgggatattcagctgtggatggcatttgttgcttttcaggacgaggtcatgaagagccctggcctgtatgccatcgaggaaggagagcaggaaaagcggaagcggtctctgaggctcgttctggagaagaagctggccatcctggagcgggccatcgaaagcaaccagagcagcgtggacctgaaacttgccaagctgaagctctgctccgagttctgggagccctccgccctggccaaagagtggcagaaactgatctttctgcatcccaacgatacagccctgtggcagaaataccttttattctgccagagccagtttagcacctttacggtgtcaaaaattcacggtctgtatggcaagtgcttgagcaccttgtctgccgtgaaggacggcagcatcttatcgcaccccgccctgccgggcaccgaggacgccatgtttggtctctttcttcagcaatgccacttcctgcggcaggctggtcactctgagaaggcggtctctctgttccaggccatggtcgacttcaccttcttcaaacccgacagtgtgaaagacctgcccaccaaaggacaggtggaattctttgagcccttctgggacagtggggagccccgggttggcgagaagggcgcccgaggctggagagcgtggatgcaccagcaggagcggggcggctgggtggtcatcagtccagatgatgatgatgatgagccagaagatgaggaccaggaaataagagagaagagcctgcccaggtggcagatctggcttgccaccgagcggtcccgagaccagaggcactggcggccgtggcgccctgataagaccaagaagcaaaccgaggaagactgtgaggatccagagagacaggtgctgtttgatgacattgcccagtctatgatccgtctttccagccaggatcttcagtttcagctggttgcggcctttctgcagttcctgggcgtgccttctggcctcagccctccagcctcctgcctctacctggccatggatgagaacagcatcttcgatgacgggctttgtgacgaaatgccactgacttttctcaacctttcctcttccggtgtcagctgtgttggctgctcagacccactgggccgccggcgctggacccggggtcacaatcgagagggcgaggagttcatccgcaacatctttcaccttgtgatgcctttgttttcaggccgggagaggtctcagctctgcttctcttggttacggtacgagatcgagaaggtcatttggtgtctgcacactaaaaacaagaagaggctaaagtcacagggaaagaactgcaagaaactagccaaaaatctcctgaaggagccagaaaaccgcaacagtttctgcctctggaagcagtacgcacatctggagtggctgcttggcaacaccgaggacgccaggaaggtgttcgatacggcgctcagcatggcggggggcagagacctgagggaccgtgagctgtgtgagctcggcctcctctacgccgggctggaggcggagctgttgccggacccgagaggggccgccacggcgcgagccgttcacgtactgaccaggctgacggagcaggggccctgcgggccctactccgggcaggcgctggccgttcacatcttgaaagctcggaaggcgtacgaacacgcgctgcaggactgtttgggcgacagctgtgtgtccgctccggctcccagcgactccttcgaccgcctgactagcctggtgaaatgcttcatgctctttcagtacttgaccgtagggatcgatgcggccgtgcgggtgtacgagcaggtgctcgcaaaactgaagggctctgttcccccagggggctccggcccggaggacggagcccgcgcccagggcccccacggcgcgctggaggccgtgacgctgatgcacacgagcctgctcaggttccacacgaaagtcagcctttaccccctggctcctctgcgccaggctctctccgaggcgttaaggttgtacccaggcaaccaggtgctttggcgggcgtacgtgcagattcagagcaggtcccacgcagccagtgagaccagaagatttttcgacgcggtcaccaggtctaccaaactcttggagccttggttgtttgcgatcgaggccgagaaaatgaggaagagactggtggagagtgttcagagggtagatggtagagaggtccacgccacaattcccgagaccggcttgacacatcgcatcagagccctgtttgaaaatgcgttgcggagcgacaacggcagccagtgccccttactgtggaggatgtacctgaattttttggtttccttaggaaacaaagaaaggagcaaaggcgtgttctacaaagcacttcagaactgtccctgggcgaaggtgctgtacctggacgccgtggagcacttccccgaagagatgcaggaggtcctggacctgatgacggagaaggagctccgggtgcgcctgcccgtcgaggagctggcgcttctgctggaggactagaccaggagggaacgggccctgccttccgggcctctcacctgctcccccaacccccccaccggagccgggatgcacaggacggggacgcatgcgtgtgagcatgtgtcacgagacctccgcttttcaagtttaattcttagtaatttgggtctgggttatcagtcttttacctcttgcacattgtttggatgtgtgaaggacacagaaccatagtttacatattgtatatgtgaatgtgtgtacgtagggaagaatcctgccaagtgaaaactaaacccgtcgtggctggcgtgcgggaggtctgttccactcctctgcccggccgtgaacgttccccactggcatccttggtggtcctgccgtcgtggtaggaaaggtctggtttctgagcactcggacctctccccgcagctggtgagcaggagagcagcttttgcccttaagagccgtttaaaacttggtgttctggcctcgctcctgttttaaaagtttctcattatttgctaggctcttgatgccacctcccttctgtggaccaggagcatcacctgggggcttgttagagatgcagcctccgggcccacctcagcccttctgagtcagggcctgcacttgaacaggaccccctggggacttaggtgcaccaagtgtgggggcgctgcccaaaggacccctgcctgggggctgtgacagaggcccagacccagacttgccaggccacattcttgttttgatttctgagggtatgagtggaatgaaacgtaaatatccacattcagaccactttcttctgaaaaggacatgcccttgcagtcattattaaggacactgagctaggaggaaattgctctatcttccctgaggtcctgctctaagagaaacgtggacagctgctgactctatcgtgatctctagaatggctgaagttgtatttctttggcatctcatccagagaagcccgtgtcgtggaagagaatcttgcctagaaaccagcggacactggtgggggagaagggcggcgggtcagggcacccgaggaaggtggctggccagccaagtggacgcttgcctcgatctgccccgcttccttcgcggcttcaagactgaactgttcagagaggggagaagtgccggaaatggatgaagaaagggagccacgttctgggccacagctcccgttacaccaggaaacttcgcagcaacagagcacacgtccagttcatctacctacactgaggagacagcatgcgttctggctaaatggaaatctccccatttgctgcatttattgtctcacaacacttgccaaaagtaaaacaacccacgcaacatgatgtgataaaaccacaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]