LOCUS       XR_001873159             105 bp    RNA     linear   VRT 11-AUG-2016
DEFINITION  PREDICTED: Lepidothrix coronata uncharacterized LOC108492581
            (LOC108492581), ncRNA.
ACCESSION   XR_001873159
VERSION     XR_001873159.1
DBLINK      BioProject: PRJNA338288
KEYWORDS    RefSeq.
SOURCE      Lepidothrix coronata (blue-crowned manakin)
  ORGANISM  Lepidothrix coronata
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Passeriformes; Pipridae;
            Lepidothrix.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_016690191.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Lepidothrix coronata Annotation
                                           Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.1
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..105
                     /organism="Lepidothrix coronata"
                     /mol_type="transcribed RNA"
                     /isolate="B3197"
                     /specimen_voucher="LSUMZ:110521"
                     /db_xref="taxon:321398"
                     /chromosome="Unknown"
                     /sex="male"
                     /dev_stage="adult"
                     /country="Peru: Loreto Department, 1.5 km S Libertad, S.
                     bank Rio Napo, 80 km N Iquitos"
     gene            1..105
                     /gene="LOC108492581"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:108492581"
     ncRNA           1..105
                     /ncRNA_class="lncRNA"
                     /gene="LOC108492581"
                     /product="uncharacterized LOC108492581"
                     /db_xref="GeneID:108492581"
ORIGIN      

gaagatgcaagcgatttgggaccttgaacaaggcaaatatggttttgtgtcttttggccatttgtaccgggagactgactcggagtcccggtatcggaaaagcac

//