2024-04-19 15:03:30, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_001873159 105 bp RNA linear VRT 11-AUG-2016 DEFINITION PREDICTED: Lepidothrix coronata uncharacterized LOC108492581 (LOC108492581), ncRNA. ACCESSION XR_001873159 VERSION XR_001873159.1 DBLINK BioProject: PRJNA338288 KEYWORDS RefSeq. SOURCE Lepidothrix coronata (blue-crowned manakin) ORGANISM Lepidothrix coronata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Passeriformes; Pipridae; Lepidothrix. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_016690191.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Lepidothrix coronata Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..105 /organism="Lepidothrix coronata" /mol_type="transcribed RNA" /isolate="B3197" /specimen_voucher="LSUMZ:110521" /db_xref="taxon:321398" /chromosome="Unknown" /sex="male" /dev_stage="adult" /country="Peru: Loreto Department, 1.5 km S Libertad, S. bank Rio Napo, 80 km N Iquitos" gene 1..105 /gene="LOC108492581" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:108492581" ncRNA 1..105 /ncRNA_class="lncRNA" /gene="LOC108492581" /product="uncharacterized LOC108492581" /db_xref="GeneID:108492581" ORIGIN
gaagatgcaagcgatttgggaccttgaacaaggcaaatatggttttgtgtcttttggccatttgtaccgggagactgactcggagtcccggtatcggaaaagcac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]