GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-04-06 09:59:07, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XR_001749918             355 bp    RNA     linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens uncharacterized LOC107984620
            (LOC107984620), transcript variant X2, ncRNA.
ACCESSION   XR_001749918
VERSION     XR_001749918.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000013.11) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..355
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="13"
     gene            1..355
                     /gene="LOC107984620"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:107984620"
     ncRNA           1..355
                     /ncRNA_class="lncRNA"
                     /gene="LOC107984620"
                     /product="uncharacterized LOC107984620, transcript variant
                     X2"
                     /db_xref="GeneID:107984620"
     variation       8
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403589165"
     variation       15
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1247080532"
     variation       17
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376549944"
     variation       25
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:576545221"
     variation       31
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:945101284"
     variation       45
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746144021"
     variation       49
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1325354169"
     variation       57
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920811932"
     variation       61
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555242707"
     variation       66
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1281106820"
     variation       79
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1324865813"
     variation       81
                     /gene="LOC107984620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:934151177"
     variation       84
                     /gene="LOC107984620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779125686"
     variation       85
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:976049845"
     variation       86
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962770950"
     variation       93
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1566259715"
     variation       95
                     /gene="LOC107984620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1209609625"
     variation       103
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240337098"
     variation       106
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337616138"
     variation       117
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188421389"
     variation       118
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193193149"
     variation       120
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:908380768"
     variation       128
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1566258328"
     variation       131
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:573900803"
     variation       132
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1172372262"
     variation       133
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1419688536"
     variation       134
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555477924"
     variation       136
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1327477664"
     variation       139
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390875521"
     variation       142
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:971254711"
     variation       148
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:540361706"
     variation       157
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1023328750"
     variation       160
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:991355170"
     variation       163
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149879782"
     variation       168
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:913159745"
     variation       169
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187909151"
     variation       173
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959867580"
     variation       178
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927040305"
     variation       182
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539422050"
     variation       189
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1159081922"
     variation       191
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1313893133"
     variation       194..200
                     /gene="LOC107984620"
                     /replace="aca"
                     /replace="acaaaca"
                     /db_xref="dbSNP:1032599019"
     variation       201
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1256621967"
     variation       207
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770021326"
     variation       208
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:569409896"
     variation       210
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1285714616"
     variation       212
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370044484"
     variation       213
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:897805661"
     variation       219
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758587365"
     variation       223
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1036338227"
     variation       226
                     /gene="LOC107984620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:967679289"
     variation       231
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475544668"
     variation       237
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1318275701"
     variation       241
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216898120"
     variation       243
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1008873625"
     variation       250
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:565771403"
     variation       254
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1050977850"
     variation       275
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750845523"
     variation       279
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:932479552"
     variation       280
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9600411"
     variation       284
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470458680"
     variation       289
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:921146980"
     variation       292
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1477676824"
     variation       294
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050171150"
     variation       298
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043848640"
     variation       303
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442028141"
     variation       304
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1360177163"
     variation       312
                     /gene="LOC107984620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1251037246"
     variation       318
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398518454"
     variation       319
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197322103"
     variation       324
                     /gene="LOC107984620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1325970516"
     variation       325
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:946516618"
     variation       326
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:547593665"
     variation       331
                     /gene="LOC107984620"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1272512924"
     variation       335
                     /gene="LOC107984620"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:987766074"
     variation       351
                     /gene="LOC107984620"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:960368042"
ORIGIN      
gcaagaaggcaaccatgagcaagccaagaagagagccctcaagggggaaccaaaaggctggctggtaccttgatcttggggtttccagcctccagaatgaatcctctggaaacactatggagtgatggagaaagcaccatctggggagtcagatgacctgctctctatcccagctcatcagggagtctctgagacaaacacttaccagagccactcttgatgatagaattggtgatgtgacagccaccaaaggaatgtgacacaaagtagaaatgagacctgagatgtggcctggacctttaccatggaaatgcccataaattgcgtccctattccttaagattttatttaaagt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]