GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2020-03-31 04:00:00, GGRNA.v2 : RefSeq release 99 (Mar, 2020)

LOCUS       XR_001739080            4428 bp    RNA     linear   PRI 02-MAR-2020
DEFINITION  PREDICTED: Homo sapiens GRIP and coiled-coil domain containing 2
            (GCC2), transcript variant X7, misc_RNA.
ACCESSION   XR_001739080
VERSION     XR_001739080.1
DBLINK      BioProject: PRJNA168
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000002.12) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Updated annotation
            Annotation Name             :: Homo sapiens Updated Annotation
                                           Release 109.20200228
            Annotation Version          :: 109.20200228
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.3
            Annotation Method           :: Best-placed RefSeq; propagated
                                           RefSeq model
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4428
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
     gene            1..4428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /note="GRIP and coiled-coil domain containing 2; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 mRNAs, 71 ESTs, 159 long SRA reads, 4 Proteins, and
                     99% coverage of the annotated genomic feature by RNAseq
                     alignments, including 41 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
     misc_RNA        1..4428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /product="GRIP and coiled-coil domain containing 2,
                     transcript variant X7"
                     /db_xref="GeneID:9648"
                     /db_xref="HGNC:HGNC:23218"
                     /db_xref="MIM:612711"
     variation       5
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:900616886"
     variation       14
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574492010"
     variation       15
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1474016978"
     variation       16
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1200624188"
     variation       19
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1255127111"
     variation       19
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1454919416"
     variation       21
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747693822"
     variation       22..27
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agcggt"
                     /replace="agcggtagcggt"
                     /db_xref="dbSNP:1162852987"
     variation       22
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1393404342"
     variation       23
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771544904"
     variation       24
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1032200284"
     variation       26
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:541919188"
     variation       27
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1473625015"
     variation       27
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764691463"
     variation       28..56
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ggcggcgg"
                     /replace="ggcggcggctggttgcgggccggcggcgg"
                     /db_xref="dbSNP:769865848"
     variation       28
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1460800506"
     variation       29
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558721939"
     variation       30..54
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="cggcggctggttgcgggccggcggc"
                     /replace="cggcggctggttgcgggccggcggctggttgcgggccggcggc"
                     /db_xref="dbSNP:1374347716"
     variation       31
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:759956198"
     variation       31
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gccag"
                     /db_xref="dbSNP:1558721960"
     variation       34
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1014717464"
     variation       38..56
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gg"
                     /replace="ggttgcgggccggcggcgg"
                     /db_xref="dbSNP:1441240714"
     variation       38
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765637800"
     variation       39
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230400164"
     variation       40
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:887917053"
     variation       41..51
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgcgggccggc"
                     /db_xref="dbSNP:1348902900"
     variation       42..58
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcgggccggcggcgggc"
                     /replace="gcgggccggcggcgggccggcggcgggc"
                     /db_xref="dbSNP:1368187862"
     variation       43
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370365824"
     variation       44
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:575208339"
     variation       47
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1306778516"
     variation       48
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:920494835"
     variation       49..64
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ggcgg"
                     /replace="ggcggcgggctggcgg"
                     /replace="ggcggcgggctggcggcgggctggcgg"
                     /db_xref="dbSNP:776397797"
     variation       49
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:896734136"
     variation       51
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274881264"
     variation       52
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1013954399"
     variation       53
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213350683"
     variation       54
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1023965750"
     variation       56
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477374361"
     variation       57
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:544110704"
     variation       58
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246928493"
     variation       63
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751810629"
     variation       66
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757471595"
     variation       67
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1427331221"
     variation       68
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1167498364"
     variation       69..70
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:774301106"
     variation       69
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1460050236"
     variation       73
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1395723889"
     variation       74
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:565602080"
     variation       77
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356542000"
     variation       80
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1301806462"
     variation       81
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767705277"
     variation       82
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138524973"
     variation       83
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:750423096"
     variation       85
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:577571534"
     variation       87
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753789053"
     variation       98
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1255782432"
     variation       99
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188633754"
     variation       102
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1186408181"
     variation       103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146387944"
     variation       109
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1470700036"
     variation       111
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752351322"
     variation       115
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:757986667"
     variation       118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1417335046"
     variation       119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:909314548"
     variation       120
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777363501"
     variation       122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1375520891"
     variation       125
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1335368291"
     variation       127
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370453746"
     variation       129
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770454650"
     variation       132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:780484058"
     variation       133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749808863"
     variation       134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2460946"
     variation       135
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1330739033"
     variation       135
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:771875009"
     variation       137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279198753"
     variation       138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385254547"
     variation       145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762716526"
     variation       147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763945167"
     variation       150
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:751176347"
     variation       151
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:756879556"
     variation       159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767161895"
     variation       163
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148209837"
     variation       165
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755657988"
     variation       167
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558723991"
     variation       169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779609657"
     variation       171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748649753"
     variation       182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758752266"
     variation       183
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1207685229"
     variation       193
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778128596"
     variation       195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747208337"
     variation       198
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483211892"
     variation       200..202
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aga"
                     /db_xref="dbSNP:775192400"
     variation       200
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421334437"
     variation       201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771135360"
     variation       203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199533705"
     variation       204
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1036704795"
     variation       208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1373516510"
     variation       212
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456640622"
     variation       213
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745986904"
     variation       216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769852533"
     variation       220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1242173002"
     variation       228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238971122"
     variation       233
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765998564"
     variation       234
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:542695116"
     variation       238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424611167"
     variation       246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1469285419"
     variation       251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763398963"
     variation       259
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1211565025"
     variation       260
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73954346"
     variation       262
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202021546"
     variation       266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1178652122"
     variation       267
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1553434715"
     variation       268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250962904"
     variation       271..278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gg"
                     /replace="ggaactgg"
                     /db_xref="dbSNP:776439377"
     variation       275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757686298"
     variation       278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:894902332"
     variation       280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374437665"
     variation       293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178718870"
     variation       296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1441173043"
     variation       300
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1292492321"
     variation       303
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1047137238"
     variation       304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750749487"
     variation       305
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202134489"
     variation       307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:866210165"
     variation       309
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780376350"
     variation       311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142334581"
     variation       312
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113579201"
     variation       314
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1199929849"
     variation       315..323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tcttct"
                     /replace="tcttcttct"
                     /db_xref="dbSNP:758868824"
     variation       319
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216506062"
     variation       321
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1487321871"
     variation       322
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:939935158"
     variation       326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1275288913"
     variation       328
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755149519"
     variation       330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778787954"
     variation       343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1431387786"
     variation       346
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558737751"
     variation       347
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200468428"
     variation       352
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894344412"
     variation       357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748107883"
     variation       359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1187652885"
     variation       361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263041888"
     variation       362
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1240014258"
     variation       365
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772082347"
     variation       370
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777741289"
     variation       371
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1169837227"
     variation       374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746838759"
     variation       375
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558737795"
     variation       378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461681625"
     variation       383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:919910894"
     variation       386
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1163590196"
     variation       388
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1347643379"
     variation       396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1390294066"
     variation       401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:868736677"
     variation       402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1375721086"
     variation       404
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766165187"
     variation       405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1285457452"
     variation       407
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376738248"
     variation       413
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1213677786"
     variation       415
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746930580"
     variation       418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:757141762"
     variation       420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370827700"
     variation       424
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368534626"
     variation       429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769292941"
     variation       435
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372290189"
     variation       436
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748848872"
     variation       441
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768145104"
     variation       446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141520578"
     variation       448
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1159766911"
     variation       452
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761016613"
     variation       453
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1413708133"
     variation       456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766775912"
     variation       458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:938366734"
     variation       460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776808644"
     variation       463..464
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35216570"
     variation       463
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1478498128"
     variation       466
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1308744812"
     variation       467
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:868566268"
     variation       472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1374790581"
     variation       482
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1026821005"
     variation       484
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1262474465"
     variation       486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759830991"
     variation       494
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1318255064"
     variation       497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:765415439"
     variation       499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373554463"
     variation       500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:915570315"
     variation       502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284739793"
     variation       506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1171350569"
     variation       512
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758608147"
     variation       513
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1438722532"
     variation       516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1198919570"
     variation       519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1237141922"
     variation       521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1456081578"
     variation       525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764264510"
     variation       526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751556782"
     variation       527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:752749562"
     variation       531
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558738514"
     variation       536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:912540674"
     variation       543
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377697070"
     variation       545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757094933"
     variation       547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1305338654"
     variation       549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:903042861"
     variation       551
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1170704241"
     variation       553
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781073297"
     variation       560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745692153"
     variation       561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755917409"
     variation       563
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779742639"
     variation       570
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748938912"
     variation       577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768163382"
     variation       583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1330573150"
     variation       588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773788157"
     variation       592
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747569256"
     variation       598
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1340529074"
     variation       600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218346299"
     variation       602
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:769277550"
     variation       606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771300150"
     variation       609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759864429"
     variation       613
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201591332"
     variation       614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:775920739"
     variation       622
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763201366"
     variation       624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1243715943"
     variation       627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:539963771"
     variation       630
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150351597"
     variation       634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751554456"
     variation       635
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1208830244"
     variation       637
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1421189786"
     variation       640
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1264689418"
     variation       641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761923647"
     variation       645
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767406173"
     variation       654
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390150348"
     variation       658..659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttacagaatcct"
                     /db_xref="dbSNP:1385104343"
     variation       662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:552450339"
     variation       663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755932248"
     variation       667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779761244"
     variation       672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753498571"
     variation       673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1337362392"
     variation       680
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1246568389"
     variation       684
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1265610795"
     variation       686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1296769383"
     variation       689
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1216625830"
     variation       693
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367729142"
     variation       694
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778423603"
     variation       695
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1007980786"
     variation       701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1017594058"
     variation       702
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747649752"
     variation       705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371673633"
     variation       708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:771587101"
     variation       710
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:781607007"
     variation       712
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746381453"
     variation       716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:758253345"
     variation       719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043247481"
     variation       720
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775949291"
     variation       726
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763300179"
     variation       729
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1443343409"
     variation       732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430018040"
     variation       740
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:564390284"
     variation       743
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761858711"
     variation       744
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:899169070"
     variation       746
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1357778821"
     variation       753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767632667"
     variation       755
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:927482380"
     variation       760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1339571489"
     variation       764
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1215840563"
     variation       767..773
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:755348339"
     variation       767
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:994906398"
     variation       772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1242140413"
     variation       774
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1310875966"
     variation       775
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:937580013"
     variation       785
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750335313"
     variation       786
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057397524"
     variation       788
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1283738431"
     variation       790
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774722092"
     variation       792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1200754713"
     variation       801
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255214947"
     variation       804
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766179585"
     variation       812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375071388"
     variation       814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753586906"
     variation       817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149070749"
     variation       818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439107634"
     variation       822
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1157395042"
     variation       828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778583148"
     variation       830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:752379605"
     variation       832
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757912028"
     variation       837
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376279109"
     variation       840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302682243"
     variation       843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746374412"
     variation       845
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756649080"
     variation       847
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1385557146"
     variation       849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761892796"
     variation       851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:749721042"
     variation       852
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1463390892"
     variation       853
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306999754"
     variation       855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:76646082"
     variation       858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1233867129"
     variation       861
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558738932"
     variation       863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1255245986"
     variation       864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1482138219"
     variation       866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774507288"
     variation       870
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1238954303"
     variation       871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1386969618"
     variation       872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748339477"
     variation       877
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1250880284"
     variation       877
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178546900"
     variation       880..900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gag"
                     /replace="gagataaataagttgaacgag"
                     /db_xref="dbSNP:1176920721"
     variation       880
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772062666"
     variation       882
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773289345"
     variation       887..889
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="ata"
                     /db_xref="dbSNP:1175935875"
     variation       887
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760633335"
     variation       891
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766341042"
     variation       894
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1452090498"
     variation       897
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776525647"
     variation       898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400490790"
     variation       899
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1445578874"
     variation       901
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1328763222"
     variation       903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759382284"
     variation       907
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:765075262"
     variation       909
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:546753702"
     variation       910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310228623"
     variation       912
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1220165389"
     variation       913
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1284425608"
     variation       915
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763543965"
     variation       918
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376224425"
     variation       919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756806500"
     variation       922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186410906"
     variation       923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1385284172"
     variation       925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558739067"
     variation       926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755402448"
     variation       930
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779282384"
     variation       935
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748344811"
     variation       939
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200408782"
     variation       942
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1171917691"
     variation       949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558739092"
     variation       950..956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaa"
                     /replace="agaagaa"
                     /db_xref="dbSNP:781322684"
     variation       960
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1423342495"
     variation       964
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773271826"
     variation       966
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201596826"
     variation       967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:924360145"
     variation       969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:553682391"
     variation       970
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1457914246"
     variation       971
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770983017"
     variation       973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:776615615"
     variation       977
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759400747"
     variation       988
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764953975"
     variation       998
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775306593"
     variation       1001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1217067767"
     variation       1003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762624813"
     variation       1005
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763857256"
     variation       1006
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1220842965"
     variation       1007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263757051"
     variation       1008
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:934492136"
     variation       1015
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1051570715"
     variation       1020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489590964"
     variation       1021
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751245972"
     variation       1022
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:535556399"
     variation       1023
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1477025570"
     variation       1025
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1184415942"
     variation       1027
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200042988"
     variation       1028
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202061636"
     variation       1030
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:755468422"
     variation       1043
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201741176"
     variation       1044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753141947"
     variation       1046
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:758664500"
     variation       1047
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:539887315"
     variation       1049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1397845853"
     variation       1059
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1351554396"
     variation       1060
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747229762"
     variation       1061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1380239386"
     variation       1063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771005293"
     variation       1065
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781192585"
     variation       1067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1262588948"
     variation       1070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141977454"
     variation       1071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218012387"
     variation       1077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769810605"
     variation       1079
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405402526"
     variation       1081
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1400602749"
     variation       1089
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1487522778"
     variation       1090
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775266412"
     variation       1091
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1347129199"
     variation       1094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:558193053"
     variation       1097
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558739320"
     variation       1104
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61729897"
     variation       1110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1180903332"
     variation       1116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774149480"
     variation       1118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199925996"
     variation       1121
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1159186035"
     variation       1123
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767153817"
     variation       1132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:927437409"
     variation       1133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:749908800"
     variation       1134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1336007488"
     variation       1138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:760076821"
     variation       1139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1297778289"
     variation       1142
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765826004"
     variation       1145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1057519387"
     variation       1146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753133550"
     variation       1150
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758866357"
     variation       1151
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1481644642"
     variation       1165
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1421904421"
     variation       1168
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:993461340"
     variation       1169
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778047476"
     variation       1178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751794952"
     variation       1181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757422255"
     variation       1182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781280877"
     variation       1185
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746008880"
     variation       1187
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769748065"
     variation       1188
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1240810622"
     variation       1189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1193332313"
     variation       1190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:534102235"
     variation       1191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749110429"
     variation       1192
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:768508067"
     variation       1196
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:774235989"
     variation       1201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:761585182"
     variation       1203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1198814494"
     variation       1214
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:574072336"
     variation       1221
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048297594"
     variation       1228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1316857514"
     variation       1239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771895994"
     variation       1242
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:772980641"
     variation       1245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1225559696"
     variation       1252
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1447793659"
     variation       1254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:949032983"
     variation       1255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375856134"
     variation       1256..1263
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aagaa"
                     /replace="aagaagaa"
                     /db_xref="dbSNP:1558739486"
     variation       1257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765805903"
     variation       1266
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369977320"
     variation       1268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1374737591"
     variation       1277
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753254448"
     variation       1278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1326973625"
     variation       1282..1289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaattaaa"
                     /db_xref="dbSNP:752944414"
     variation       1285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1281990243"
     variation       1292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374813941"
     variation       1296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1448662773"
     variation       1301
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1344757214"
     variation       1302
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1393854068"
     variation       1307
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404677344"
     variation       1308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764466155"
     variation       1310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260381807"
     variation       1320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751881094"
     variation       1325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1198848160"
     variation       1326
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1237083074"
     variation       1330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369170580"
     variation       1334
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1200948483"
     variation       1337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767784682"
     variation       1340
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61746003"
     variation       1344
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1167702345"
     variation       1345..1349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aga"
                     /replace="agaga"
                     /db_xref="dbSNP:1477651601"
     variation       1345
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1197102034"
     variation       1346
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1048154580"
     variation       1351
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555252199"
     variation       1355
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1466384395"
     variation       1359
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:773384748"
     variation       1363..1365
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1394461749"
     variation       1363
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1444139642"
     variation       1364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:779938219"
     variation       1365
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1004130499"
     variation       1368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1035232214"
     variation       1371
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749267870"
     variation       1372
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1006736114"
     variation       1376
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1331092618"
     variation       1377
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754922343"
     variation       1379..1383
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:756135294"
     variation       1384..1389
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atatca"
                     /db_xref="dbSNP:1341495036"
     variation       1385
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:959784795"
     variation       1386..1389
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="atca"
                     /db_xref="dbSNP:1218883900"
     variation       1387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778958751"
     variation       1394
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1157197068"
     variation       1397
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257604297"
     variation       1398
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1336881383"
     variation       1400
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1022524104"
     variation       1401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:968390662"
     variation       1403
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1211043257"
     variation       1407
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748009845"
     variation       1409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760868283"
     variation       1410
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:978383532"
     variation       1419..1431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agaaaaa"
                     /replace="agaaaaagaaaaa"
                     /db_xref="dbSNP:777760783"
     variation       1423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771983890"
     variation       1425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1478004008"
     variation       1426
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1193224912"
     variation       1430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1553438402"
     variation       1431..1441
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="attaa"
                     /replace="attaacattaa"
                     /db_xref="dbSNP:745790902"
     variation       1431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147654490"
     variation       1434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772987604"
     variation       1436
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746578708"
     variation       1442
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:1423349948"
     variation       1445
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142684498"
     variation       1452
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775957002"
     variation       1454
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140818127"
     variation       1455
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:943194201"
     variation       1457
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1038941538"
     variation       1458
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920490239"
     variation       1459
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:930649631"
     variation       1462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190820622"
     variation       1464
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146700196"
     variation       1465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1246499911"
     variation       1471
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1047693033"
     variation       1472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:762231999"
     variation       1474
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145247044"
     variation       1476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:978819011"
     variation       1485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1377604308"
     variation       1488
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149652536"
     variation       1490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185517792"
     variation       1492..1498
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagcaag"
                     /db_xref="dbSNP:1488502523"
     variation       1492
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1215702024"
     variation       1496..1501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagaag"
                     /db_xref="dbSNP:771974664"
     variation       1501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766508161"
     variation       1502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372937652"
     variation       1504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753899949"
     variation       1506
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1237970379"
     variation       1511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:556272156"
     variation       1515
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1442812086"
     variation       1519
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1274881421"
     variation       1521..1523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="ttt"
                     /db_xref="dbSNP:779888794"
     variation       1524
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381407477"
     variation       1525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1419608695"
     variation       1526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779054955"
     variation       1527
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748096672"
     variation       1530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:758275416"
     variation       1531..1535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="at"
                     /replace="attat"
                     /db_xref="dbSNP:1558739859"
     variation       1532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:777375176"
     variation       1533
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1334360314"
     variation       1534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:746698287"
     variation       1535
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770450276"
     variation       1536
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776316287"
     variation       1537
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745440605"
     variation       1547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183575645"
     variation       1549
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1373973137"
     variation       1556
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774841781"
     variation       1558
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762248388"
     variation       1561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767889211"
     variation       1563
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773406502"
     variation       1576
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1460045507"
     variation       1578..1585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aag"
                     /replace="aagtcaag"
                     /db_xref="dbSNP:746744919"
     variation       1578..1579
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1442513029"
     variation       1582..1583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:768578200"
     variation       1584
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439677984"
     variation       1588
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:761066885"
     variation       1590
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200958316"
     variation       1591
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754082179"
     variation       1596..1601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aatgaa"
                     /db_xref="dbSNP:776384329"
     variation       1597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200270126"
     variation       1598
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765343878"
     variation       1600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205671661"
     variation       1601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1332839102"
     variation       1605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752697494"
     variation       1607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758365184"
     variation       1608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1304732223"
     variation       1613
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1257044582"
     variation       1619
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148359301"
     variation       1620
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1031375413"
     variation       1624
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751351993"
     variation       1626
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111527126"
     variation       1629
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370488160"
     variation       1632..1638
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gcag"
                     /replace="gcagcag"
                     /db_xref="dbSNP:1200741086"
     variation       1632
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:528729535"
     variation       1634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745455759"
     variation       1643
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480328029"
     variation       1645
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175995115"
     variation       1647
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769306376"
     variation       1650
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1434246089"
     variation       1658
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1490121597"
     variation       1659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748202873"
     variation       1663
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:940939996"
     variation       1666
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1427602721"
     variation       1667..1708
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atg"
                     /replace="atgcccttctcgaaactgtgaatcgcctccagggagaaaatg"
                     /db_xref="dbSNP:1315005166"
     variation       1667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111613095"
     variation       1671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467952366"
     variation       1672..1676
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="cttct"
                     /db_xref="dbSNP:1558740067"
     variation       1677
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:540949615"
     variation       1678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:562126455"
     variation       1682
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:772493105"
     variation       1684
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1352409978"
     variation       1687
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1176292274"
     variation       1690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377282558"
     variation       1691
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761006452"
     variation       1697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:771325509"
     variation       1699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346503661"
     variation       1701
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1305544670"
     variation       1706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282438487"
     variation       1709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776999762"
     variation       1710
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759778171"
     variation       1711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1279003695"
     variation       1713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1467723931"
     variation       1716
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765431163"
     variation       1719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1202595118"
     variation       1726
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752787189"
     variation       1727
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1489117399"
     variation       1735
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:763095072"
     variation       1737..1738
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ac"
                     /db_xref="dbSNP:1423397180"
     variation       1738
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763988821"
     variation       1739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1175972132"
     variation       1741
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751509052"
     variation       1751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1195400958"
     variation       1756
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371790236"
     variation       1757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1427539820"
     variation       1759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1167781340"
     variation       1768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780981207"
     variation       1770
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147501385"
     variation       1772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1302431416"
     variation       1776
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1363495038"
     variation       1780
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755720124"
     variation       1781
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779646741"
     variation       1783
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369626877"
     variation       1784
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1361609748"
     variation       1795..1804
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agtc"
                     /replace="agtctcagtc"
                     /db_xref="dbSNP:761581032"
     variation       1796
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768195223"
     variation       1797
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778213807"
     variation       1798
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1019082050"
     variation       1799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1245928069"
     variation       1810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1290135176"
     variation       1811
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1489482701"
     variation       1812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747487244"
     variation       1813
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771216512"
     variation       1814
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222504208"
     variation       1815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1485361240"
     variation       1817
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1323747305"
     variation       1818
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184380647"
     variation       1819
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373780548"
     variation       1821
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:964534174"
     variation       1824
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759869953"
     variation       1825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162868458"
     variation       1836..1838
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaa"
                     /db_xref="dbSNP:756971621"
     variation       1839
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1402462037"
     variation       1842
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1383371246"
     variation       1843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:770183232"
     variation       1845
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298626440"
     variation       1847
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:920522699"
     variation       1848
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1428913746"
     variation       1853
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:61733788"
     variation       1855
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:550791699"
     variation       1857
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1470443354"
     variation       1858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010141859"
     variation       1865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:377725944"
     variation       1869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1356545280"
     variation       1873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774169009"
     variation       1877
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200008152"
     variation       1879
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284064502"
     variation       1892
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:767246456"
     variation       1894
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750255811"
     variation       1895
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1426501841"
     variation       1896
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773730114"
     variation       1897
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371376562"
     variation       1904
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143706341"
     variation       1916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747355682"
     variation       1919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753488471"
     variation       1923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:754454908"
     variation       1924
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:778431070"
     variation       1925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939317682"
     variation       1933
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1282502541"
     variation       1935
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139691316"
     variation       1937
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753625999"
     variation       1939
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757744857"
     variation       1941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178521867"
     variation       1942
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1398374320"
     variation       1943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1407187260"
     variation       1945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895191613"
     variation       1948
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781756304"
     variation       1952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:948209315"
     variation       1955..1956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:769325355"
     variation       1961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373924982"
     variation       1965..1969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agtag"
                     /db_xref="dbSNP:1379176443"
     variation       1967
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1448191708"
     variation       1969
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145077426"
     variation       1973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1274371671"
     variation       1976..1980
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="caatc"
                     /db_xref="dbSNP:1216852012"
     variation       1976
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:770271101"
     variation       1978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1221355978"
     variation       1986
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61741717"
     variation       1990
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749469344"
     variation       1991
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1024464817"
     variation       1993
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260734243"
     variation       1996
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:191279740"
     variation       2001
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761764768"
     variation       2004
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1329552835"
     variation       2007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1031657685"
     variation       2009
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1460307482"
     variation       2019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1483560293"
     variation       2020
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61739749"
     variation       2022..2028
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="agga"
                     /replace="aggagga"
                     /db_xref="dbSNP:772664758"
     variation       2024
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:891475133"
     variation       2026
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740583"
     variation       2027
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767490206"
     variation       2029
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773116841"
     variation       2033
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367881891"
     variation       2034
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1411624165"
     variation       2038
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:920857758"
     variation       2041..2044
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ttaa"
                     /db_xref="dbSNP:1402557746"
     variation       2042..2046
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="taaaa"
                     /db_xref="dbSNP:763502591"
     variation       2042
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1182461304"
     variation       2043..2052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaag"
                     /replace="aaaagaaaag"
                     /db_xref="dbSNP:766736753"
     variation       2048
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1353341747"
     variation       2053
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1439184703"
     variation       2056
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140310167"
     variation       2057
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1345221071"
     variation       2058
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:766099385"
     variation       2060
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:555677090"
     variation       2063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558740656"
     variation       2067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:576244953"
     variation       2071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:764688075"
     variation       2077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752293612"
     variation       2080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1436046060"
     variation       2083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:757826462"
     variation       2084
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:182645789"
     variation       2085
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372074612"
     variation       2086
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150938411"
     variation       2097
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749502433"
     variation       2098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1475864400"
     variation       2099
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150078317"
     variation       2100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1394396750"
     variation       2101
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376990612"
     variation       2105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304241885"
     variation       2111
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772129982"
     variation       2113..2118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:759852289"
     variation       2113..2115
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:752109794"
     variation       2113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1226547497"
     variation       2118
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1403426657"
     variation       2119
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773135239"
     variation       2121
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141805666"
     variation       2122
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1391057767"
     variation       2132..2133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:767887598"
     variation       2132
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1269123750"
     variation       2133
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369088854"
     variation       2138
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1298541997"
     variation       2139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372865093"
     variation       2141
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200389027"
     variation       2145
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577283127"
     variation       2146
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375946212"
     variation       2147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759222318"
     variation       2156
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:61741893"
     variation       2158..2162
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aataa"
                     /db_xref="dbSNP:752891062"
     variation       2159
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764991505"
     variation       2166
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:762619155"
     variation       2171
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:945879082"
     variation       2174..2181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaaaa"
                     /replace="aaaaaaaaa"
                     /db_xref="dbSNP:756364486"
     variation       2174
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763638702"
     variation       2178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1406749496"
     variation       2182
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750989248"
     variation       2189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1371440005"
     variation       2194
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1473780638"
     variation       2202..2203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:1164785165"
     variation       2203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1558740890"
     variation       2204..2210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tttttt"
                     /replace="ttttttt"
                     /db_xref="dbSNP:777909420"
     variation       2208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776466243"
     variation       2210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:780392284"
     variation       2216..2220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1160864211"
     variation       2216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:754274589"
     variation       2217
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186457569"
     variation       2219..2225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaga"
                     /replace="aagaaga"
                     /db_xref="dbSNP:553103180"
     variation       2223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:779257690"
     variation       2224
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:748248613"
     variation       2227
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772156346"
     variation       2228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1358697601"
     variation       2233
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777785198"
     variation       2236..2241
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaagaa"
                     /db_xref="dbSNP:757374682"
     variation       2239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1259075581"
     variation       2243
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368592749"
     variation       2245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770899061"
     variation       2246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372319248"
     variation       2253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776412280"
     variation       2257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759260339"
     variation       2260..2264
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:779791241"
     variation       2262
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444328870"
     variation       2267..2268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tt"
                     /db_xref="dbSNP:1230076424"
     variation       2274
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1290111450"
     variation       2286
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759436302"
     variation       2287
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1242578153"
     variation       2289
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:769472880"
     variation       2292..2296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="taatt"
                     /db_xref="dbSNP:746975961"
     variation       2294
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364766321"
     variation       2308
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:553327544"
     variation       2315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762645439"
     variation       2317
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1405508254"
     variation       2320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992533570"
     variation       2321
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741028"
     variation       2323
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763728337"
     variation       2332..2336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="ttatt"
                     /db_xref="dbSNP:1392708707"
     variation       2335
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138472765"
     variation       2336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761384692"
     variation       2337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916577022"
     variation       2341
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1364082251"
     variation       2343
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1381340267"
     variation       2349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766964266"
     variation       2354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750341029"
     variation       2356
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1336144112"
     variation       2362
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cc"
                     /db_xref="dbSNP:1238134261"
     variation       2363..2364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1258733483"
     variation       2365..2371
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaa"
                     /replace="aaagaaa"
                     /db_xref="dbSNP:1055792867"
     variation       2371
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325973107"
     variation       2373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755370564"
     variation       2377
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260191310"
     variation       2378
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779086346"
     variation       2379
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:752942121"
     variation       2387
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1181053232"
     variation       2391
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1251796166"
     variation       2394..2395
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="caa"
                     /db_xref="dbSNP:1419002672"
     variation       2395..2396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ag"
                     /db_xref="dbSNP:1382806587"
     variation       2401
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758583225"
     variation       2402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1379714687"
     variation       2405
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757883913"
     variation       2406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741151"
     variation       2409..2415
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgtt"
                     /replace="tgttgtt"
                     /db_xref="dbSNP:768523280"
     variation       2409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:948157020"
     variation       2411
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1223836489"
     variation       2416
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764900269"
     variation       2419
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376201616"
     variation       2421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1293344874"
     variation       2422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1467722939"
     variation       2427
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014322616"
     variation       2428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:781259774"
     variation       2433
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368499106"
     variation       2434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540561575"
     variation       2440
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1347103200"
     variation       2441
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558741197"
     variation       2445..2446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1224383207"
     variation       2446
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147267352"
     variation       2453
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749060582"
     variation       2457
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1321520535"
     variation       2460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768472292"
     variation       2468
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:62000420"
     variation       2472
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962155514"
     variation       2476
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:761471420"
     variation       2485
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766868631"
     variation       2486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777206295"
     variation       2489
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373358076"
     variation       2490
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1480930422"
     variation       2493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1199715610"
     variation       2497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765668476"
     variation       2500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377548265"
     variation       2502
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558741259"
     variation       2503
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1293995034"
     variation       2504
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1263972654"
     variation       2507
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774873391"
     variation       2510
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1181789592"
     variation       2516
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1479248738"
     variation       2521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202022886"
     variation       2523
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:964071112"
     variation       2525
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1461440891"
     variation       2527..2530
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="cttc"
                     /db_xref="dbSNP:1296335720"
     variation       2532
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1380536974"
     variation       2537
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758744395"
     variation       2539
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374201747"
     variation       2542
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751776542"
     variation       2545
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1302288457"
     variation       2547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:757364490"
     variation       2548
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1052721221"
     variation       2550
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:781076781"
     variation       2554
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1296418496"
     variation       2560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:1366183315"
     variation       2560
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745847876"
     variation       2563
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1306956276"
     variation       2565
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147227525"
     variation       2566..2570
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="t"
                     /replace="tcttt"
                     /db_xref="dbSNP:1558741343"
     variation       2569
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780117635"
     variation       2572
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1294514823"
     variation       2574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1490652955"
     variation       2581
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1222296847"
     variation       2582
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749153398"
     variation       2583
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367728508"
     variation       2585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558741376"
     variation       2592
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370623394"
     variation       2596
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747741971"
     variation       2597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:771631848"
     variation       2598
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1168245988"
     variation       2601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1336979954"
     variation       2605
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1387071496"
     variation       2606
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1361987402"
     variation       2607
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1040053435"
     variation       2608
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772560484"
     variation       2611
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760204378"
     variation       2612..2617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="agttag"
                     /db_xref="dbSNP:781183137"
     variation       2614
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1162752039"
     variation       2616
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:563097138"
     variation       2621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201325666"
     variation       2625..2627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aca"
                     /db_xref="dbSNP:925811579"
     variation       2626
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775964196"
     variation       2627
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139623765"
     variation       2633
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146256742"
     variation       2634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751795034"
     variation       2639
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:757380227"
     variation       2641
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1392507603"
     variation       2642
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144062162"
     variation       2643
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:894451722"
     variation       2644
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1444078397"
     variation       2645
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:951929244"
     variation       2648
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1319064296"
     variation       2652
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:527733249"
     variation       2653
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1014683399"
     variation       2655..2660
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tct"
                     /replace="tcttct"
                     /db_xref="dbSNP:747772330"
     variation       2656
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1005083150"
     variation       2662
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1485331180"
     variation       2665
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:536516536"
     variation       2666
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1186194933"
     variation       2667..2672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaa"
                     /replace="gaagaa"
                     /db_xref="dbSNP:1202843350"
     variation       2669
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1244424916"
     variation       2671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:567813236"
     variation       2672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149051213"
     variation       2673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749167273"
     variation       2675
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243229382"
     variation       2685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200328829"
     variation       2687
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1014849447"
     variation       2688
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778799262"
     variation       2689
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747868838"
     variation       2690
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1451858435"
     variation       2696
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771664379"
     variation       2699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777463225"
     variation       2703
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452583533"
     variation       2705
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1313471572"
     variation       2707
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:992073362"
     variation       2708..2711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tt"
                     /replace="tttt"
                     /db_xref="dbSNP:1558741601"
     variation       2709
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376001079"
     variation       2711
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1373019080"
     variation       2719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1224741919"
     variation       2722..2728
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaag"
                     /replace="gaagaag"
                     /db_xref="dbSNP:769389279"
     variation       2725
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:746562390"
     variation       2727..2730
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="agta"
                     /db_xref="dbSNP:772930314"
     variation       2730
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424149870"
     variation       2732
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1385964891"
     variation       2734
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775980873"
     variation       2736
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763395652"
     variation       2739..2740
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="at"
                     /db_xref="dbSNP:1182556330"
     variation       2739
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:993580082"
     variation       2748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1235725178"
     variation       2753
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1027769388"
     variation       2757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769032581"
     variation       2759
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:916608229"
     variation       2760
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1406948239"
     variation       2764..2775
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="gaaaaa"
                     /replace="gaaaaagaaaaa"
                     /db_xref="dbSNP:1471744452"
     variation       2766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178798839"
     variation       2770
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774737186"
     variation       2776
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762213492"
     variation       2790
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374523392"
     variation       2795
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1490152565"
     variation       2799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:750652114"
     variation       2800
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151131536"
     variation       2802
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766504781"
     variation       2805
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:567509759"
     variation       2810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147113988"
     variation       2815
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1284743129"
     variation       2820
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1322611947"
     variation       2825
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778966752"
     variation       2830
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1222443730"
     variation       2831
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751461574"
     variation       2836..2840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ag"
                     /replace="aggag"
                     /db_xref="dbSNP:1439543677"
     variation       2840
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205071225"
     variation       2842
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:902683816"
     variation       2843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1481909936"
     variation       2844
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371074235"
     variation       2850
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:925335557"
     variation       2851
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777356661"
     variation       2852
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:746606214"
     variation       2853
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1029375087"
     variation       2856
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142522262"
     variation       2857
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:780634068"
     variation       2858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1366658848"
     variation       2863
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748627738"
     variation       2866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:769572125"
     variation       2867
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:772341027"
     variation       2869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138827624"
     variation       2870
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:771330093"
     variation       2871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:933489795"
     variation       2872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1362992732"
     variation       2873
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775165071"
     variation       2879
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1248048275"
     variation       2884
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1182216335"
     variation       2885
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144683999"
     variation       2886
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1292269123"
     variation       2890
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1188078487"
     variation       2893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:776983164"
     variation       2895
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:759759979"
     variation       2900..2903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ct"
                     /replace="ctct"
                     /db_xref="dbSNP:1208301358"
     variation       2904
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1286683427"
     variation       2906
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249613038"
     variation       2908
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765298197"
     variation       2910
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1558742437"
     variation       2912
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:965465988"
     variation       2913..2916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaa"
                     /db_xref="dbSNP:1417198054"
     variation       2913
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:775304894"
     variation       2919..2923
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gttgg"
                     /db_xref="dbSNP:1246244416"
     variation       2920
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1042628793"
     variation       2924..2925
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aaaaaaa"
                     /db_xref="dbSNP:1447003740"
     variation       2926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184707117"
     variation       2934
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762900631"
     variation       2936
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761600051"
     variation       2937
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260851474"
     variation       2943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1218124658"
     variation       2945..2949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1251727905"
     variation       2945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:767241149"
     variation       2946
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1184094290"
     variation       2950..2954
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="gaatg"
                     /db_xref="dbSNP:981067132"
     variation       2950
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750094291"
     variation       2952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:751037716"
     variation       2953
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234487157"
     variation       2960..2961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:1480106752"
     variation       2962..2964
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="aag"
                     /db_xref="dbSNP:1409395750"
     variation       2964
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182135420"
     variation       2968
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755719987"
     variation       2970
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765913754"
     variation       2973
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1464512757"
     variation       2977
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1197336886"
     variation       2978
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753434393"
     variation       2979
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374554854"
     variation       2983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370690279"
     variation       2997
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754436218"
     variation       2998
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:778414438"
     variation       2999
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775133111"
     variation       3003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201741301"
     variation       3004
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201533301"
     variation       3006..3015
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaagaa"
                     /replace="aaagaaagaa"
                     /db_xref="dbSNP:1379177165"
     variation       3009
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1300703183"
     variation       3014
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1310476331"
     variation       3019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1230280873"
     variation       3021
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:540350740"
     variation       3023
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770097002"
     variation       3024
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749450889"
     variation       3038
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:768804002"
     variation       3039
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:778920396"
     variation       3041
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748191151"
     variation       3046
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772043861"
     variation       3050
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369476264"
     variation       3052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1163802954"
     variation       3054
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1478364800"
     variation       3063
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1348399041"
     variation       3064
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:773117197"
     variation       3065
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760588617"
     variation       3066
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:770568579"
     variation       3070
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1481167189"
     variation       3071
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776363038"
     variation       3073
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764871527"
     variation       3075
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200632066"
     variation       3076..3083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ga"
                     /replace="gaaaagga"
                     /db_xref="dbSNP:1294024072"
     variation       3080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:963686194"
     variation       3081
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775180642"
     variation       3083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:992064468"
     variation       3091
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373531562"
     variation       3094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1228174598"
     variation       3099
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1310983408"
     variation       3100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:974061040"
     variation       3105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768202885"
     variation       3106
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:756514438"
     variation       3108
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199582186"
     variation       3110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1400799163"
     variation       3112
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766603690"
     variation       3115
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333097633"
     variation       3127
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1463993580"
     variation       3128
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1015529394"
     variation       3130
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:754116992"
     variation       3131
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112414104"
     variation       3142
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765508224"
     variation       3143
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:752852118"
     variation       3147
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1402766997"
     variation       3156
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200698017"
     variation       3157
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1345028400"
     variation       3164
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1218593126"
     variation       3165
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1276494505"
     variation       3166
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1309185054"
     variation       3177
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043026548"
     variation       3178
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423737921"
     variation       3179
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:777666786"
     variation       3182..3186
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1173525178"
     variation       3186
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1250765827"
     variation       3190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746999034"
     variation       3191
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145961164"
     variation       3194
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:745710611"
     variation       3205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:769643756"
     variation       3207
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:748897129"
     variation       3208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768308979"
     variation       3210
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773774486"
     variation       3211
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199920630"
     variation       3212
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139373750"
     variation       3214
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:777189992"
     variation       3215
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1325051408"
     variation       3216
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1558748773"
     variation       3228
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:961545411"
     variation       3229
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1331317699"
     variation       3233..3238
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aattaa"
                     /db_xref="dbSNP:1297922376"
     variation       3237..3241
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aagaa"
                     /db_xref="dbSNP:755939952"
     variation       3237
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:759901263"
     variation       3243
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369977045"
     variation       3245
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765528847"
     variation       3246
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752940087"
     variation       3251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1008229275"
     variation       3254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1273683937"
     variation       3257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1161025040"
     variation       3268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:763285911"
     variation       3275
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1166742035"
     variation       3277..3282
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aa"
                     /replace="aatgaa"
                     /db_xref="dbSNP:1462193829"
     variation       3278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:760393036"
     variation       3280..3284
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ga"
                     /replace="gaaga"
                     /db_xref="dbSNP:1319298198"
     variation       3287
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764284016"
     variation       3293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1397662496"
     variation       3295
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150549327"
     variation       3296
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761805619"
     variation       3297
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767581549"
     variation       3299
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139867631"
     variation       3304
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:750413831"
     variation       3310
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1196396069"
     variation       3312
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1400697261"
     variation       3324..3330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atta"
                     /replace="attatta"
                     /db_xref="dbSNP:1558749221"
     variation       3325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762166594"
     variation       3328
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766073111"
     variation       3330
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1266296314"
     variation       3334
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1271461409"
     variation       3342
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1385757799"
     variation       3344
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1326304266"
     variation       3348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1231267860"
     variation       3349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1271988906"
     variation       3353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370403999"
     variation       3354
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1333849411"
     variation       3357
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:780117653"
     variation       3367
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141225250"
     variation       3368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:978616285"
     variation       3369
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:540191458"
     variation       3373
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778432512"
     variation       3374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:561373947"
     variation       3380
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1450117592"
     variation       3390
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1472695864"
     variation       3392
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771506645"
     variation       3397
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:777225487"
     variation       3400
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746492141"
     variation       3402
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1173033029"
     variation       3408
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770339104"
     variation       3409
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:775966369"
     variation       3411
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112143014"
     variation       3413
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1309592184"
     variation       3422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1302222404"
     variation       3423
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1249329980"
     variation       3425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1387197812"
     variation       3428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:772479486"
     variation       3429
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1209968900"
     variation       3430
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:773563468"
     variation       3431
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:766506745"
     variation       3434
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:112971525"
     variation       3436
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759479296"
     variation       3444
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1448704314"
     variation       3445
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1440973448"
     variation       3448
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1166476755"
     variation       3450
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765054604"
     variation       3454
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1190032468"
     variation       3456
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1238462585"
     variation       3459
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752586160"
     variation       3460
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:758118731"
     variation       3462
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1361037016"
     variation       3465
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388586464"
     variation       3466
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:763805735"
     variation       3469
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:751148636"
     variation       3474
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756776491"
     variation       3475
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2718698"
     variation       3478
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1315251271"
     variation       3484
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:776376279"
     variation       3486
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:764254276"
     variation       3487
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142611820"
     variation       3493
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1414857869"
     variation       3497
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755553644"
     variation       3499
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1260090078"
     variation       3500
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:533881757"
     variation       3501
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:779270856"
     variation       3507
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1458299039"
     variation       3508
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748611623"
     variation       3511
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:151289779"
     variation       3514
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778153215"
     variation       3517
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747178123"
     variation       3520
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1415631486"
     variation       3521
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1424647828"
     variation       3526
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1325419433"
     variation       3529
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1312668795"
     variation       3531
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:761579405"
     variation       3534
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1277861717"
     variation       3540
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767262699"
     variation       3544
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:749975866"
     variation       3547
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760245435"
     variation       3551
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:765755225"
     variation       3561
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1192991650"
     variation       3574
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1426537811"
     variation       3575
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753276945"
     variation       3577
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1172190231"
     variation       3580
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1372757727"
     variation       3585
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:759015773"
     variation       3593
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:927576463"
     variation       3597
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150423177"
     variation       3600
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:142777791"
     variation       3601
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1439441831"
     variation       3609
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1276083510"
     variation       3613..3620
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aacaa"
                     /replace="aacaacaa"
                     /db_xref="dbSNP:746365647"
     variation       3617
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1303050399"
     variation       3618
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143737097"
     variation       3621
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:781485417"
     variation       3622
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1005737514"
     variation       3625
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1300981933"
     variation       3626
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1343962219"
     variation       3634
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1202439691"
     variation       3640
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:866490440"
     variation       3642
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1205597910"
     variation       3646
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:746022977"
     variation       3649
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1039516171"
     variation       3650
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:756242710"
     variation       3651
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:779960812"
     variation       3652..3659
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="caaaaaca"
                     /db_xref="dbSNP:1558750723"
     variation       3658
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:749344356"
     variation       3660
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:375968480"
     variation       3666
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1423306291"
     variation       3667
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:965819512"
     variation       3671
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774263627"
     variation       3672
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1456568396"
     variation       3673
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:747941337"
     variation       3678
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1168319647"
     variation       3679
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1418410717"
     variation       3682
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1279630183"
     variation       3685
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:753889331"
     variation       3686
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1340034632"
     variation       3687..3688
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:760543706"
     variation       3689
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1383278698"
     variation       3692
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1164577647"
     variation       3693
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371419991"
     variation       3697
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:748029412"
     variation       3699
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1162137907"
     variation       3704
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1390811870"
     variation       3706
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1439976770"
     variation       3708..3714
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1026397447"
     variation       3710
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:771930600"
     variation       3713
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201741171"
     variation       3715
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746798568"
     variation       3719
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:770550098"
     variation       3722..3728
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaaaa"
                     /replace="aaaaaaa"
                     /replace="aaaaaaaa"
                     /db_xref="dbSNP:760884932"
     variation       3724
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776419181"
     variation       3728
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1334403676"
     variation       3729
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:759122367"
     variation       3730
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1558751667"
     variation       3736
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:764785824"
     variation       3737
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:762189707"
     variation       3741
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768039941"
     variation       3748
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1260097871"
     variation       3751
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369363942"
     variation       3754..3757
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="aaaa"
                     /replace="aaaaa"
                     /db_xref="dbSNP:1409085692"
     variation       3758
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371706600"
     variation       3762
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376460288"
     variation       3765
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237737956"
     variation       3766
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1474665198"
     variation       3768
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766588884"
     variation       3769
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753998058"
     variation       3771..3772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="gg"
                     /db_xref="dbSNP:1457709646"
     variation       3772
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1306024671"
     variation       3773
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1157870118"
     variation       3776
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368958563"
     variation       3783
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369747246"
     variation       3787
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1334538821"
     variation       3789
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:762300159"
     variation       3792
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759793368"
     variation       3799
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:765421952"
     variation       3810
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1234557370"
     variation       3812
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1050094389"
     variation       3813
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1303138344"
     variation       3816
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:752777880"
     variation       3827
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1388589708"
     variation       3828
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1348990551"
     variation       3836
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779584230"
     variation       3842
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:533500477"
     variation       3843
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1010946455"
     variation       3846..3850
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="ca"
                     /replace="catca"
                     /db_xref="dbSNP:1051912718"
     variation       3846
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1332631187"
     variation       3849
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:754477036"
     variation       3857
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:778523077"
     variation       3858
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1485455575"
     variation       3864
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1021365021"
     variation       3865
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031269477"
     variation       3866
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1404396524"
     variation       3867
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1346459110"
     variation       3868
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:747634829"
     variation       3869
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144078912"
     variation       3871
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111823638"
     variation       3872
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41280574"
     variation       3877
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1457744633"
     variation       3882
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:954168656"
     variation       3885
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:548223516"
     variation       3886
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1414066111"
     variation       3887
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:770087901"
     variation       3888
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147550431"
     variation       3889
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:763198265"
     variation       3891
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1452133427"
     variation       3893
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1304934172"
     variation       3898
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1380914128"
     variation       3900
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1444883031"
     variation       3902
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:985615983"
     variation       3903
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369984459"
     variation       3904..3919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tac"
                     /replace="tacgctaagtgcatac"
                     /db_xref="dbSNP:1558752584"
     variation       3906
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:774543551"
     variation       3907
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149849446"
     variation       3914
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:767562609"
     variation       3915
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1345819253"
     variation       3916
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1284954649"
     variation       3919
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:750323927"
     variation       3922
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:755993632"
     variation       3926
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1061202"
     variation       3927
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1257498831"
     variation       3929
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766154317"
     variation       3930
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1210366792"
     variation       3938
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:753544225"
     variation       3941
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1249531562"
     variation       3943
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:754707101"
     variation       3945
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1177816192"
     variation       3946
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373111221"
     variation       3947
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:747724362"
     variation       3949
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1449777234"
     variation       3952
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1178735235"
     variation       3953
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:567930302"
     variation       3954
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:918884510"
     variation       3956
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:929060807"
     variation       3957
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377405233"
     variation       3961
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:746326735"
     variation       3970
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373591045"
     variation       3979
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1280652233"
     variation       3981
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:769785023"
     variation       3983
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775406077"
     variation       3986..3989
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="tgac"
                     /db_xref="dbSNP:1396995824"
     variation       3991
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:768387950"
     variation       3999
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1420302565"
     variation       4003
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1175646405"
     variation       4005
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048526317"
     variation       4007
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:762001026"
     variation       4008
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761409091"
     variation       4011
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:889959359"
     variation       4013
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1455451585"
     variation       4019
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:767174442"
     variation       4022
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1394727280"
     variation       4029
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201598096"
     variation       4034
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760256265"
     variation       4037
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:765843796"
     variation       4040
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:939766734"
     variation       4042
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1390875585"
     variation       4043
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1212522497"
     variation       4047
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:753198031"
     variation       4049
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372100844"
     variation       4051
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1442166911"
     variation       4052
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12104502"
     variation       4055
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:895614689"
     variation       4061
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1280481528"
     variation       4067
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1226027616"
     variation       4068
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:751922360"
     variation       4069
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:901467304"
     variation       4074
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:550647621"
     variation       4075
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781465261"
     variation       4077
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:569137853"
     variation       4079
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1194705666"
     variation       4080
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:773834644"
     variation       4083
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:779983908"
     variation       4087
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1044734650"
     variation       4088
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:904420878"
     variation       4090..4096
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="acaa"
                     /replace="acaacaa"
                     /db_xref="dbSNP:1484081118"
     variation       4090
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1000234141"
     variation       4093
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:749179357"
     variation       4094
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143480889"
     variation       4097
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1200823043"
     variation       4098
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1031666308"
     variation       4099
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:774060667"
     variation       4100
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:747959489"
     variation       4103
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370787694"
     variation       4105
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772853681"
     variation       4109
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1325657570"
     variation       4110
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532944652"
     variation       4112..4116
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="tgt"
                     /replace="tgtgt"
                     /db_xref="dbSNP:771577824"
     variation       4113
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:761073703"
     variation       4115
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1213272486"
     variation       4126
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1558755166"
     variation       4127
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373039945"
     variation       4128
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1326630594"
     variation       4129
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:776172312"
     variation       4134
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201191345"
     variation       4135
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:764642889"
     variation       4137
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376647881"
     variation       4139
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1235617480"
     variation       4148
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1369225049"
     variation       4152
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:760933546"
     variation       4160
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1363521410"
     variation       4167..4176
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="atgatga"
                     /replace="atgatgatga"
                     /db_xref="dbSNP:1558756688"
     variation       4168
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1452057912"
     variation       4170
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1367437976"
     variation       4172
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:766572412"
     variation       4173
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374912295"
     variation       4177
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:755016874"
     variation       4180
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:778728618"
     variation       4181
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1376925926"
     variation       4188
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="aa"
                     /db_xref="dbSNP:754762170"
     variation       4189
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370316650"
     variation       4190
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368044415"
     variation       4192
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1237686107"
     variation       4195
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1282793986"
     variation       4196
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:577919832"
     variation       4197
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1028058886"
     variation       4199
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:545008599"
     variation       4201
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:745378850"
     variation       4203
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374403850"
     variation       4205
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:774746560"
     variation       4207
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:748725727"
     variation       4208
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:772413848"
     variation       4215
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1041395116"
     variation       4219
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:756740240"
     variation       4220
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150908938"
     variation       4221
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:766656471"
     variation       4223
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1174750876"
     variation       4225
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1356880494"
     variation       4227
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:759584353"
     variation       4230
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1298747880"
     variation       4231
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765328971"
     variation       4237
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:901600438"
     variation       4239
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1444331771"
     variation       4242
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:752679442"
     variation       4243
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139394961"
     variation       4247
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116357144"
     variation       4250
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1276752529"
     variation       4251
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1350870505"
     variation       4253
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:751403336"
     variation       4254
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1205268592"
     variation       4255
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:757110639"
     variation       4257
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781045802"
     variation       4258
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367971760"
     variation       4260
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1253949910"
     variation       4261
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:755615332"
     variation       4268
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:572029170"
     variation       4269
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143689284"
     variation       4272
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1422620950"
     variation       4273
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1411197349"
     variation       4278
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1297922860"
     variation       4280
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1170510108"
     variation       4284
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200216159"
     variation       4285
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376989193"
     variation       4292
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:773706329"
     variation       4293
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1371532273"
     variation       4305
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:747433973"
     variation       4311
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1273335952"
     variation       4315
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1364320233"
     variation       4316
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1252477551"
     variation       4318
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:771264998"
     variation       4320
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:776879822"
     variation       4325
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1316600646"
     variation       4328
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1430049655"
     variation       4331
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1216036588"
     variation       4333
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1178726008"
     variation       4335
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1481353761"
     variation       4336
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1421414425"
     variation       4337
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1274345577"
     variation       4340
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:765328188"
     variation       4348
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1219786909"
     variation       4349
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73954367"
     variation       4353
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1189551783"
     variation       4361
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1243175854"
     variation       4363..4364
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace=""
                     /replace="ca"
                     /db_xref="dbSNP:1296459600"
     variation       4363
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:781636962"
     variation       4365
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746160286"
     variation       4366
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1223545372"
     variation       4368
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:531054649"
     variation       4372
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:775568817"
     variation       4374..4379
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="caa"
                     /replace="caacaa"
                     /db_xref="dbSNP:1340316463"
     variation       4374
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:763147628"
     variation       4379
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:768831588"
     variation       4386
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:959631427"
     variation       4393
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1257526463"
     variation       4396
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:774466917"
     variation       4406
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1185404663"
     variation       4418
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:761869351"
     variation       4420
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:767509179"
     variation       4421
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:750240618"
     variation       4422
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:760385592"
     variation       4425
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:766115496"
     variation       4428
                     /gene="GCC2"
                     /gene_synonym="GCC185; RANBP2L4; REN53"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1248568495"
ORIGIN      
ggctggcgcaaacagaagtgcagcggtggcggcggctggttgcgggccggcggcgggctggcggagatggaggtaactcaggatcttgttcaagatggggtggcttcaccagctacccctgggaccgggaaatctaagctggaaacattgcccaaagaagacctcatcaagtttgccaagaaacagatgatgctaatacagaaagctaaatcaaggtgtacagaattggagaaagaaattgaagaactcagatcaaaacctgttactgaaggaactggtgatattattaaggcattaactgaacgtctggatgctcttcttctggaaaaagcagagactgagcaacagtgtctttctctgaaaaaggaaaatataaaaatgaagcaagaggttgaggattctgtaacaaagatgggagatgcacataaggagttggaacaatcacatataaactatgtgaaagaaattgaaaatttgaaaaatgagttgatggcagtacgttccaaatacagtgaagacaaagctaacttacaaaagcagctggaagaagcaatgaatacgcaattagaactttcagaacaacttaaatttcagaacaactctgaagataatgttaaaaaactacaagaagagattgagaaaattaggccaggctttgaggagcaaattttatatctgcaaaagcaattagacgctaccactgatgaaaagaaggaaacagttactcaactccaaaatatcattgaggctaattctcagcattaccaaaaaaatattaatagtttgcaggaagagcttttacagttgaaagctatacaccaagaagaggtgaaagagttgatgtgccagattgaagcatcagctaaggaacatgaagcagagataaataagttgaacgagctaaaagagaacttagtaaaacaatgtgaggcaagtgaaaagaacatccagaagaaatatgaatgtgagttagaaaatttaaggaaagccacctcaaatgcaaaccaagacaatcagatatgttctattctcttgcaagaaaatacatttgtagaacaagtagtaaatgaaaaagtcaaacacttagaagataccttaaaagaacttgaatctcaacacagtatcttaaaagatgaggtaacttatatgaataatcttaagttaaaacttgaaatggatgctcaacatataaaggatgagttttttcatgaacgggaagacttagagtttaaaattaatgaattattactagctaaagaagaacagggctgtgtaattgaaaaattaaaatctgagctagcaggtttaaataaacagttttgctatactgtagaacagcataacagagaagtacagagtcttaaggaacaacatcaaaaagaaatatcagaactaaatgagacatttttgtcagattcagaaaaagaaaaattaacattaatgtttgaaatacagggtcttaaggaacagtgtgaaaacctacagcaagaaaagcaagaagcaattttaaattatgagagtttacgagagattatggaaattttacaaacagaactgggggaatctgctggaaaaataagtcaagagttcgaatcaatgaagcaacagcaagcatctgatgttcatgaactgcagcagaagctcagaactgcttttactgaaaaagatgcccttctcgaaactgtgaatcgcctccagggagaaaatgaaaagttactatctcaacaagaattggtaccagaacttgaaaataccataaagaaccttcaagaaaagaatggagtatacttacttagtctcagtcaaagagataccatgttaaaagaattagaaggaaagataaattctcttactgaggaaaaagatgattttataaataaactgaaaaattcccatgaagaaatggataatttccataagaaatgtgaaagggaagaaagattgattcttgaacttgggaagaaagtagagcaaacaatccagtacaacagtgaactagaacaaaaggtaaatgaattaacaggaggactagaggagactttaaaagaaaaggatcaaaatgaccaaaaactagaaaaacttatggttcaaatgaaagttctctctgaagacaaagaagtattgtcagctgaagtgaagtctctttatgaggaaaacaataaactcagttcagaaaaaaaacagttgagtagggatttggaggtttttttgtctcaaaaagaagatgttatccttaaagaacatattactcaattagaaaagaaacttcagttaatggttgaagagcaagataatttaaataaactgcttgaaaatgagcaagttcagaagttatttgttaaaactcagttgtatggttttcttaaagaaatgggatcagaagtttcagaagacagtgaagagaaagatgttgttaatgtcctacaggcagtcggtgaatccttggcaaaaataaatgaggaaaaatgcaacctggcttttcagcgtgatgaaaaagtattagagttagaaaaagagattaagtgccttcaagaagagagtgtagttcagtgtgaagaacttaagtctttattgagagactatgagcaagagaaagttctcttaaggaaagagttagaagaaatacagtcagaaaaagaggccctgcagtctgatcttctagaaatgaagaatgctaatgaaaaaacaaggcttgaaaatcagaatcttttaattcaagttgaagaagtatctcaaacatgtagcaaaagtgaaatccataatgaaaaagaaaaatgttttataaaggaacatgaaaacctaaagccactactagaacaaaaagaattacgagataggagagcagagttgatactattaaaggattccttagcaaaatcaccttctgtaaaaaatgatcctctgtcttcagtaaaagagttggaagaaaaaatagaaaatctggaaaaagaatgcaaagaaaaggaggagaaaataaataagataaaattagttgccgtaaaggcaaagaaagaactagattccagcagaaaagagacccagactgtgaaggaagaacttgaatctcttcgatcagaaaaggaccagttatctgcttccatgagagatctcattcaaggagcagaaagctataagaatcttttattagaatatgaaaagcagtcagagcaactggatgtggaaaaagaacgtgctaataattttgagcatcgtattgaagaccttacaagacaattaagaaattcgactttgcagtgtgaaacaataaattctgataatgaagatctcctggctcgtattgagacattacagtctaatgccaaattattagaagtacagattttagaagtccagagagccaaagcaatggtagacaaagaattagaagctgaaaaacttcagaaagaacagaagataaaggaacatgccactactgtaaatgaacttgaagaacttcaggtacaacttcaaaagcaaaagaaacagcttcagaaaaccatgcaagaattagagctggttaaaaaggatgcccaacaaaccacattgatgaatatggaaatagctgattatgaacgtttgatgaaagaactaaatcaaaagttaactaataaaaacaacaagatagaagatttggagcaagaaataaaaattcaaaaacagaaacaagaaaccctacaagaagaaataacttcattacagtcttcagtacaacaatatgaagaaaaaaacaccaaaatcaagcaattgcttgtgaaaaccaaaaaggaactggcagattcaaagcaagcagaaactgatcacttaatacttcaagcatctttaaaagatacagctggctgaaataacatcagagaagcacaaaatccacgagcacctgaaaacctctgcggaacagcaccagcgtacgctaagtgcataccagcagagagtgacagcactacaggaagagtgccgtgctgccaagggaacatctggaaatgctgattgaccagctaaaaatcaaattacaagatagccaaaataacttacagattaatgtatctgaacttcaaacattgcagtctgaacatgatacactgctagaaaggcacaacaagatgctgcaggaaactgtgtccaaagaggcggaactccgggaaaaattgtgttcaatacagtcagagaacatgatgatgaaatctgaacatacacagactgtgagtcagctaacatcccagaacgaggtccttcgaaatagcttccgagatcaagtgcgacatttgcaggaagaacacagaaagacagtggagacattacagcagcagctctccaagatggaagcacagctcttccagcttaagaatgaaccgaccacaagaagcccagtttcctctcaacaatctttgaagaaccttcgagaaaggagaaacacagacctcccgcttctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]