2024-04-25 21:20:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_001636371 144 bp RNA linear VRT 03-MAY-2016 DEFINITION PREDICTED: Sinocyclocheilus rhinocerous uncharacterized LOC107708522 (LOC107708522), ncRNA. ACCESSION XR_001636371 VERSION XR_001636371.1 DBLINK BioProject: PRJNA319352 KEYWORDS RefSeq. SOURCE Sinocyclocheilus rhinocerous ORGANISM Sinocyclocheilus rhinocerous Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Ostariophysi; Cypriniformes; Cyprinidae; Cyprininae; Sinocyclocheilus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_015647040.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Sinocyclocheilus rhinocerous Annotation Release 100 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.0 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..144 /organism="Sinocyclocheilus rhinocerous" /mol_type="transcribed RNA" /isolate="Xijiao" /db_xref="taxon:307959" /chromosome="Unknown" /sex="female" /tissue_type="muscle" /dev_stage="adult" /country="China: Luoping, Yunnan" /collection_date="2012-08-20" /note="semi-cave-dwelling" gene 1..144 /gene="LOC107708522" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 1 sample with support for all annotated introns" /db_xref="GeneID:107708522" ncRNA 1..144 /ncRNA_class="lncRNA" /gene="LOC107708522" /product="uncharacterized LOC107708522" /db_xref="GeneID:107708522" ORIGIN
caaacaagagaaaacgtatctcaaaccccattgcacaccgtttccaggaaacgtgttgttcaaccccgaaaccgtagcaaaatgttgcgcaccggtttgaccttgaacgtgccccaggcgtctatggtggtttttgcagtccat
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]