GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-25 21:20:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_001636371             144 bp    RNA     linear   VRT 03-MAY-2016
DEFINITION  PREDICTED: Sinocyclocheilus rhinocerous uncharacterized
            LOC107708522 (LOC107708522), ncRNA.
ACCESSION   XR_001636371
VERSION     XR_001636371.1
DBLINK      BioProject: PRJNA319352
KEYWORDS    RefSeq.
SOURCE      Sinocyclocheilus rhinocerous
  ORGANISM  Sinocyclocheilus rhinocerous
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Ostariophysi;
            Cypriniformes; Cyprinidae; Cyprininae; Sinocyclocheilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_015647040.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Sinocyclocheilus rhinocerous
                                           Annotation Release 100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.0
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..144
                     /organism="Sinocyclocheilus rhinocerous"
                     /mol_type="transcribed RNA"
                     /isolate="Xijiao"
                     /db_xref="taxon:307959"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="muscle"
                     /dev_stage="adult"
                     /country="China: Luoping, Yunnan"
                     /collection_date="2012-08-20"
                     /note="semi-cave-dwelling"
     gene            1..144
                     /gene="LOC107708522"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:107708522"
     ncRNA           1..144
                     /ncRNA_class="lncRNA"
                     /gene="LOC107708522"
                     /product="uncharacterized LOC107708522"
                     /db_xref="GeneID:107708522"
ORIGIN      
caaacaagagaaaacgtatctcaaaccccattgcacaccgtttccaggaaacgtgttgttcaaccccgaaaccgtagcaaaatgttgcgcaccggtttgaccttgaacgtgccccaggcgtctatggtggtttttgcagtccat
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]