LOCUS       XR_001392226             159 bp    RNA     linear   MAM 27-NOV-2015
DEFINITION  PREDICTED: Ceratotherium simum simum uncharacterized LOC106803079
            (LOC106803079), ncRNA.
ACCESSION   XR_001392226
VERSION     XR_001392226.1
DBLINK      BioProject: PRJNA191537
KEYWORDS    RefSeq.
SOURCE      Ceratotherium simum simum (southern white rhinoceros)
  ORGANISM  Ceratotherium simum simum
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Perissodactyla; Rhinocerotidae;
            Ceratotherium.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_004454226.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Ceratotherium simum simum Annotation
                                           Release 101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.5
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..159
                     /organism="Ceratotherium simum simum"
                     /mol_type="transcribed RNA"
                     /isolate="SDZICR_KB13650"
                     /sub_species="simum"
                     /db_xref="taxon:73337"
                     /chromosome="Unknown"
                     /sex="female"
                     /country="USA: San Diego Zoo, California"
     gene            1..159
                     /gene="LOC106803079"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 8 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:106803079"
     ncRNA           1..159
                     /ncRNA_class="lncRNA"
                     /gene="LOC106803079"
                     /product="uncharacterized LOC106803079"
                     /db_xref="GeneID:106803079"
ORIGIN      

ggaactccgaacgtccagacctacatctccctacagggccatcggtgacccggctggagaccttgaacgtaaatcagcatcagtccaggggcctggtggtaaggtgggaatccatgtttgtgtctgaagtgcttagcaataaagccaaggtggtgagtg

//