GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-20 18:25:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_001363839             164 bp    RNA     linear   MAM 04-NOV-2015
DEFINITION  PREDICTED: Myotis brandtii uncharacterized LOC106727611
            (LOC106727611), ncRNA.
ACCESSION   XR_001363839
VERSION     XR_001363839.1
DBLINK      BioProject: PRJNA218631
KEYWORDS    RefSeq.
SOURCE      Myotis brandtii (Brandt's bat)
  ORGANISM  Myotis brandtii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Laurasiatheria; Chiroptera; Microchiroptera;
            Vespertilionidae; Myotis.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_005367384.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Myotis brandtii Annotation Release
                                           101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..164
                     /organism="Myotis brandtii"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:109478"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="Russia: Perm poKrai"
                     /lat_lon="58.8348 N 57.6119 E"
                     /collection_date="Dec-2011"
                     /note="collected at hibernation roost"
     gene            1..164
                     /gene="LOC106727611"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 1 sample
                     with support for all annotated introns"
                     /db_xref="GeneID:106727611"
     ncRNA           1..164
                     /ncRNA_class="lncRNA"
                     /gene="LOC106727611"
                     /product="uncharacterized LOC106727611"
                     /db_xref="GeneID:106727611"
ORIGIN      
gagcatcagaagctcagtttaatcatcttacaatacccacttgcccgcacaggaccttgaacatgttggaaaataaaaggagtgaagactgagaaatgagtgaattgatattcaaaaaataacacattgctaggtttcctaatatgttgtcagaaagatggagc
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]