LOCUS       XR_001263035             147 bp    RNA     linear   PLN 25-AUG-2015
DEFINITION  PREDICTED: Brassica oleracea var. oleracea uncharacterized
            LOC106305681 (LOC106305681), ncRNA.
ACCESSION   XR_001263035
VERSION     XR_001263035.1
DBLINK      BioProject: PRJNA293438
KEYWORDS    RefSeq.
SOURCE      Brassica oleracea var. oleracea
  ORGANISM  Brassica oleracea var. oleracea
            Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
            Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae;
            Pentapetalae; rosids; malvids; Brassicales; Brassicaceae;
            Brassiceae; Brassica.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_013617412.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Brassica oleracea Annotation Release
                                           100
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 6.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..147
                     /organism="Brassica oleracea var. oleracea"
                     /mol_type="transcribed RNA"
                     /variety="oleracea"
                     /cultivar="TO1000"
                     /db_xref="taxon:109376"
                     /chromosome="C7"
                     /country="Canada"
                     /lat_lon="52.1333 N 106.6833 W"
                     /collection_date="31-Aug-2009"
     gene            1..147
                     /gene="LOC106305681"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 6 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:106305681"
     ncRNA           1..147
                     /ncRNA_class="lncRNA"
                     /gene="LOC106305681"
                     /product="uncharacterized LOC106305681"
                     /db_xref="GeneID:106305681"
ORIGIN      

gtggaaagccaagagctgagacaaaactaaaaagtgcagtccagttgcaagacctattagatgcaacaagaatgttagttccccatacaagaccaggtcgtgagagtgatagtgatccagaagaccttgaacatgctgagaagcttc

//