GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-03-29 09:33:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XR_001109241             192 bp    RNA     linear   PRI 28-JUN-2017
DEFINITION  PREDICTED: Aotus nancymaae uncharacterized LOC105725242
            (LOC105725242), ncRNA.
ACCESSION   XR_001109241
VERSION     XR_001109241.1
DBLINK      BioProject: PRJNA282745
KEYWORDS    RefSeq.
SOURCE      Aotus nancymaae (Ma's night monkey)
  ORGANISM  Aotus nancymaae
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Platyrrhini; Aotidae; Aotus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_018509519.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Version          :: Aotus nancymaae Annotation Release
                                           101
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 7.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..192
                     /organism="Aotus nancymaae"
                     /mol_type="transcribed RNA"
                     /isolate="86115"
                     /db_xref="taxon:37293"
                     /chromosome="Unknown"
                     /sex="female"
                     /tissue_type="blood"
     gene            1..192
                     /gene="LOC105725242"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 2 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:105725242"
     ncRNA           1..192
                     /ncRNA_class="lncRNA"
                     /gene="LOC105725242"
                     /product="uncharacterized LOC105725242"
                     /db_xref="GeneID:105725242"
ORIGIN      
cgatactcctgcctcagcctcctgagtagctgggatgacagtcttgggaagttgtagaggaagaatggagcatgagaagacaaagctggaggttgagtgaaagcaactctctgagattttcatggaaggacgtttattttatctggcaaggttgaccttgaactcccacactcaagcaatcctcccacctcg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]