2024-03-29 09:33:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XR_001109241 192 bp RNA linear PRI 28-JUN-2017 DEFINITION PREDICTED: Aotus nancymaae uncharacterized LOC105725242 (LOC105725242), ncRNA. ACCESSION XR_001109241 VERSION XR_001109241.1 DBLINK BioProject: PRJNA282745 KEYWORDS RefSeq. SOURCE Aotus nancymaae (Ma's night monkey) ORGANISM Aotus nancymaae Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Platyrrhini; Aotidae; Aotus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_018509519.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Aotus nancymaae Annotation Release 101 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 7.4 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..192 /organism="Aotus nancymaae" /mol_type="transcribed RNA" /isolate="86115" /db_xref="taxon:37293" /chromosome="Unknown" /sex="female" /tissue_type="blood" gene 1..192 /gene="LOC105725242" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 100% coverage of the annotated genomic feature by RNAseq alignments, including 2 samples with support for all annotated introns" /db_xref="GeneID:105725242" ncRNA 1..192 /ncRNA_class="lncRNA" /gene="LOC105725242" /product="uncharacterized LOC105725242" /db_xref="GeneID:105725242" ORIGIN
cgatactcctgcctcagcctcctgagtagctgggatgacagtcttgggaagttgtagaggaagaatggagcatgagaagacaaagctggaggttgagtgaaagcaactctctgagattttcatggaaggacgtttattttatctggcaaggttgaccttgaactcccacactcaagcaatcctcccacctcg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]