LOCUS       XR_001102096             922 bp    RNA     linear   INV 10-APR-2020
DEFINITION  PREDICTED: Bombus impatiens uncharacterized LOC100747124
            (LOC100747124), ncRNA.
ACCESSION   XR_001102096
VERSION     XR_001102096.3
DBLINK      BioProject: PRJNA70395
KEYWORDS    RefSeq.
SOURCE      Bombus impatiens (common eastern bumble bee)
  ORGANISM  Bombus impatiens
            Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Hexapoda; Insecta;
            Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita;
            Aculeata; Apoidea; Anthophila; Apidae; Bombus; Pyrobombus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NT_176574.1) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Apr 10, 2020 this sequence version replaced XR_001102096.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI
            Annotation Status           :: Full annotation
            Annotation Name             :: Bombus impatiens Annotation Release
                                           103
            Annotation Version          :: 103
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 8.4
            Annotation Method           :: Best-placed RefSeq; Gnomon
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..922
                     /organism="Bombus impatiens"
                     /mol_type="transcribed RNA"
                     /isolation_source="haploid male brothers"
                     /db_xref="taxon:132113"
                     /chromosome="Unknown"
                     /sex="male"
                     /country="USA"
     gene            1..922
                     /gene="LOC100747124"
                     /note="Derived by automated computational analysis using
                     gene prediction method: Gnomon. Supporting evidence
                     includes similarity to: 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 197
                     samples with support for all annotated introns"
                     /db_xref="GeneID:100747124"
     ncRNA           1..922
                     /ncRNA_class="lncRNA"
                     /gene="LOC100747124"
                     /product="uncharacterized LOC100747124"
                     /db_xref="GeneID:100747124"
ORIGIN      

tatttaatctaaataatgtaaataacttataatacaaatatattatatataattgttacaacagtttaactaattaaaacatcaatgtttcgaaaacaatagtcaattattacagtaattcaaatattcccgcttgcggtatcgatcaagagggaagtacaacatatatatatatatatatatacgtatataaatatgtatatataccgtgcaatgcaacgaaagtgttgcttttgcaatatacattatatttaactacatagatttgaggaatttcagcaaagccatttgatttgaaaaaaacttttaaaaagcttaatataaaaagtgttataagaattaattactagacaagagtataaacttttaactattgtagataacctgttgttacccaaacgtaatcaaagcataagaattttattgtaaatgagtgattctgcataaattgcactattgtacaaaacgttaataagagcaccttgaagaaaggaagaaacttcgttttcatataaagcttattttgattttaaaagttaactaaaaagtaaaaagcaataatcaattgaaaatgtttaaatttttggtacatctaaatgtctattttgtaaatagtggtattattgaatagaaatatgtaatactaatatcttttttagataaccttaagcattgggatttatgctggtatatatataagtcaaaactatgagatacctcgtatagatgagcctaagaagataatagaacgaataaaggaaattacagatgaatataaaaaaaaataattaatgatttatctaataatactattacgtttgtggaataagttttaatccagtttattgtacatatacgtttatatatataaacatgtaacacaatttgatttggtttgattttaataaaacattttatgtaa

//