2024-05-03 21:12:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_747716 1203 bp mRNA linear PLN 18-APR-2022 DEFINITION Aspergillus fumigatus Af293 zinc-dependent alcohol dehydrogenase, putative (AFUA_1G14390), partial mRNA. ACCESSION XM_747716 VERSION XM_747716.1 DBLINK BioProject: PRJNA14003 BioSample: SAMN00115746 KEYWORDS RefSeq. SOURCE Aspergillus fumigatus Af293 ORGANISM Aspergillus fumigatus Af293 Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae; Aspergillus; Aspergillus subgen. Fumigati. REFERENCE 1 (bases 1 to 1203) AUTHORS Nierman,W.C., Pain,A., Anderson,M.J., Wortman,J.R., Kim,H.S., Arroyo,J., Berriman,M., Abe,K., Archer,D.B., Bermejo,C., Bennett,J., Bowyer,P., Chen,D., Collins,M., Coulsen,R., Davies,R., Dyer,P.S., Farman,M., Fedorova,N., Fedorova,N., Feldblyum,T.V., Fischer,R., Fosker,N., Fraser,A., Garcia,J.L., Garcia,M.J., Goble,A., Goldman,G.H., Gomi,K., Griffith-Jones,S., Gwilliam,R., Haas,B., Haas,H., Harris,D., Horiuchi,H., Huang,J., Humphray,S., Jimenez,J., Keller,N., Khouri,H., Kitamoto,K., Kobayashi,T., Konzack,S., Kulkarni,R., Kumagai,T., Lafon,A., Latge,J.P., Li,W., Lord,A., Lu,C., Majoros,W.H., May,G.S., Miller,B.L., Mohamoud,Y., Molina,M., Monod,M., Mouyna,I., Mulligan,S., Murphy,L., O'Neil,S., Paulsen,I., Penalva,M.A., Pertea,M., Price,C., Pritchard,B.L., Quail,M.A., Rabbinowitsch,E., Rawlins,N., Rajandream,M.A., Reichard,U., Renauld,H., Robson,G.D., Rodriguez de Cordoba,S., Rodriguez-Pena,J.M., Ronning,C.M., Rutter,S., Salzberg,S.L., Sanchez,M., Sanchez-Ferrero,J.C., Saunders,D., Seeger,K., Squares,R., Squares,S., Takeuchi,M., Tekaia,F., Turner,G., Vazquez de Aldana,C.R., Weidman,J., White,O., Woodward,J., Yu,J.H., Fraser,C., Galagan,J.E., Asai,K., Machida,M., Hall,N., Barrell,B. and Denning,D.W. TITLE Genomic sequence of the pathogenic and allergenic filamentous fungus Aspergillus fumigatus JOURNAL Nature 438 (7071), 1151-1156 (2005) PUBMED 16372009 REMARK Erratum:[Nature. 2006 Jan 26;439(7075):502. Lafton, Anne [corrected to Lafon, Anne]] REFERENCE 2 (bases 1 to 1203) CONSRTM NCBI Genome Project TITLE Direct Submission JOURNAL Submitted (15-APR-2022) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA REFERENCE 3 (bases 1 to 1203) AUTHORS Nierman,W., Wortman,J., Pain,A., Anderson,M.J., Arroya,J., Hall,N., Barrell,B., Fraser,C. and Denning,D.W. TITLE Direct Submission JOURNAL Submitted (20-MAY-2005) The Institute for Genomic Research, 9712 Medical Center Dr, Rockville, MD 20850, USA COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. This record is derived from an annotated genomic sequence (NC_007194). COMPLETENESS: incomplete on both ends. FEATURES Location/Qualifiers source 1..1203 /organism="Aspergillus fumigatus Af293" /mol_type="mRNA" /strain="Af293" /db_xref="taxon:330879" /chromosome="1" gene <1..>1203 /locus_tag="AFUA_1G14390" /old_locus_tag="Afu1g14390" /db_xref="GeneID:3509820" CDS 1..1203 /locus_tag="AFUA_1G14390" /old_locus_tag="Afu1g14390" /EC_number="1.1.1.14" /note="encoded by transcript AFUA_1G14390A; similar to Sorbitol dehydrogenase (EC 1.1.1.14) (L-iditol 2-dehydrogenase). (Swiss-Prot:P27867) [Rattus norvegicus]" /codon_start=1 /product="zinc-dependent alcohol dehydrogenase, putative" /protein_id="XP_752809.1" /db_xref="GeneID:3509820" /translation="
MTTTTTTTALVLHGAKDLRLESRPISPPTGSEVQVAIRATGLCGSDLHYYNHGRNGDFVVREPMCLGHESSGTVTAVGPDVTTLQVGDRVALEVGLPCRTCTLCRTGRYNICPDMKFRSSAKLFPHLDGTLMELTNHPADLCHKLPESVSYAGGALVEPLAVCLHAIRRSHPPTPAEVDLATEQGDQTAALIFGAGAIGLLLAAALATSQPFTSIVIADIDPARLEIAKSLNLGLKTHLLPKGGNAANPPPAPDASAAEHAAYAMQNAQRTAAALKEANGVASGFVRVYECTGVPACVQAGIYAASPGAVLVQIGMGNPIQTLPVSAAALREVDIIGTFRYDGHAYPAAIELMASGKLDHVEKQVVTHRVRLEDGSRAFALAGKGVDETGRPVVKVVIES"
misc_feature 25..1197 /locus_tag="AFUA_1G14390" /old_locus_tag="Afu1g14390" /note="Sorbitol dehydrogenase; Region: sorbitol_DH; cd05285" /db_xref="CDD:176188" misc_feature order(127..129,133..135,145..147,163..165,172..174, 202..204,349..351,358..360,472..474,946..948,1015..1020) /locus_tag="AFUA_1G14390" /note="inhibitor binding site [active]" /db_xref="CDD:176188" misc_feature order(127..129,133..135,202..207,472..474) /locus_tag="AFUA_1G14390" /note="catalytic Zn binding site [ion binding]; other site" /db_xref="CDD:176188" misc_feature order(292..294,301..303,310..312,334..336) /locus_tag="AFUA_1G14390" /note="structural Zn binding site [ion binding]; other site" /db_xref="CDD:176188" misc_feature order(484..486,532..534,652..660,670..672,787..789, 871..876,880..882,940..948,1012..1020) /locus_tag="AFUA_1G14390" /note="NADP binding site [chemical binding]; other site" /db_xref="CDD:176188" misc_feature order(490..492,526..528,565..567,574..582,637..639, 664..666,721..723,829..831,1042..1044,1051..1056, 1063..1065) /locus_tag="AFUA_1G14390" /note="tetramer interface [polypeptide binding]; other site" /db_xref="CDD:176188" ORIGIN
atgaccaccacaaccaccacaacagcactcgtcctccatggagccaaagatctccgcctggaatcacgacccatctctcctcccaccggctccgaagtccaagttgccatccgcgcaaccggtctctgcggctcagaccttcactactacaaccacggccgcaatggcgacttcgtcgtgcgcgagccgatgtgcctgggccacgaatcctccggcaccgtcacagctgtcggaccagacgtgacaaccctgcaggtcggcgaccgcgtcgccctcgaggtcggcctcccttgccgtacctgcaccctctgccgcactggccgctacaacatctgcccggacatgaagttccgcagcagcgctaagctcttcccccatctcgacggcaccctcatggaactcaccaaccaccccgccgatctctgccacaagcttcctgagagtgtctcctacgccggcggcgccctcgtcgagcccctcgctgtctgcctgcacgccatccgccgctcgcacccgcccacccccgccgaagtggatctggccaccgaacagggcgaccagaccgccgcgctgatcttcggcgcaggagccatcggcctcctcctcgccgctgcactagccacctcccagcccttcacctccatcgtcatcgcggacatcgaccccgcccgtctcgagatcgcaaaatccctcaacctaggcctgaagacccatctcctccccaagggcggcaatgccgccaacccaccccctgcgccggacgcctctgccgcagagcatgccgcgtacgccatgcagaatgcgcagcggaccgcagcggcgctgaaagaggcgaatggggttgcgtcagggtttgtgcgcgtgtacgagtgtaccggcgtgccggcgtgcgtgcaggcggggatctacgctgccagccctggcgccgtgctcgtgcagatcgggatggggaatccgattcagacgcttccggtgagtgcggcggcgctccgggaggtggatatcatcggcacgttccggtatgatggccatgcgtacccggctgcaattgagttgatggctagtgggaagcttgaccatgtcgagaagcaggttgttacgcatcgcgtcagacttgaggatgggagtcgggcgtttgcgctggcggggaagggagtggatgagactggcaggccggtggtcaaggtcgtcattgagagctag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]