GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-03 21:12:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_747716               1203 bp    mRNA    linear   PLN 18-APR-2022
DEFINITION  Aspergillus fumigatus Af293 zinc-dependent alcohol dehydrogenase,
            putative (AFUA_1G14390), partial mRNA.
ACCESSION   XM_747716
VERSION     XM_747716.1
DBLINK      BioProject: PRJNA14003
            BioSample: SAMN00115746
KEYWORDS    RefSeq.
SOURCE      Aspergillus fumigatus Af293
  ORGANISM  Aspergillus fumigatus Af293
            Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
            Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
            Aspergillus; Aspergillus subgen. Fumigati.
REFERENCE   1  (bases 1 to 1203)
  AUTHORS   Nierman,W.C., Pain,A., Anderson,M.J., Wortman,J.R., Kim,H.S.,
            Arroyo,J., Berriman,M., Abe,K., Archer,D.B., Bermejo,C.,
            Bennett,J., Bowyer,P., Chen,D., Collins,M., Coulsen,R., Davies,R.,
            Dyer,P.S., Farman,M., Fedorova,N., Fedorova,N., Feldblyum,T.V.,
            Fischer,R., Fosker,N., Fraser,A., Garcia,J.L., Garcia,M.J.,
            Goble,A., Goldman,G.H., Gomi,K., Griffith-Jones,S., Gwilliam,R.,
            Haas,B., Haas,H., Harris,D., Horiuchi,H., Huang,J., Humphray,S.,
            Jimenez,J., Keller,N., Khouri,H., Kitamoto,K., Kobayashi,T.,
            Konzack,S., Kulkarni,R., Kumagai,T., Lafon,A., Latge,J.P., Li,W.,
            Lord,A., Lu,C., Majoros,W.H., May,G.S., Miller,B.L., Mohamoud,Y.,
            Molina,M., Monod,M., Mouyna,I., Mulligan,S., Murphy,L., O'Neil,S.,
            Paulsen,I., Penalva,M.A., Pertea,M., Price,C., Pritchard,B.L.,
            Quail,M.A., Rabbinowitsch,E., Rawlins,N., Rajandream,M.A.,
            Reichard,U., Renauld,H., Robson,G.D., Rodriguez de Cordoba,S.,
            Rodriguez-Pena,J.M., Ronning,C.M., Rutter,S., Salzberg,S.L.,
            Sanchez,M., Sanchez-Ferrero,J.C., Saunders,D., Seeger,K.,
            Squares,R., Squares,S., Takeuchi,M., Tekaia,F., Turner,G., Vazquez
            de Aldana,C.R., Weidman,J., White,O., Woodward,J., Yu,J.H.,
            Fraser,C., Galagan,J.E., Asai,K., Machida,M., Hall,N., Barrell,B.
            and Denning,D.W.
  TITLE     Genomic sequence of the pathogenic and allergenic filamentous
            fungus Aspergillus fumigatus
  JOURNAL   Nature 438 (7071), 1151-1156 (2005)
   PUBMED   16372009
  REMARK    Erratum:[Nature. 2006 Jan 26;439(7075):502. Lafton, Anne [corrected
            to Lafon, Anne]]
REFERENCE   2  (bases 1 to 1203)
  CONSRTM   NCBI Genome Project
  TITLE     Direct Submission
  JOURNAL   Submitted (15-APR-2022) National Center for Biotechnology
            Information, NIH, Bethesda, MD 20894, USA
REFERENCE   3  (bases 1 to 1203)
  AUTHORS   Nierman,W., Wortman,J., Pain,A., Anderson,M.J., Arroya,J., Hall,N.,
            Barrell,B., Fraser,C. and Denning,D.W.
  TITLE     Direct Submission
  JOURNAL   Submitted (20-MAY-2005) The Institute for Genomic Research, 9712
            Medical Center Dr, Rockville, MD 20850, USA
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. This record is derived from an annotated genomic
            sequence (NC_007194).
            COMPLETENESS: incomplete on both ends.
FEATURES             Location/Qualifiers
     source          1..1203
                     /organism="Aspergillus fumigatus Af293"
                     /mol_type="mRNA"
                     /strain="Af293"
                     /db_xref="taxon:330879"
                     /chromosome="1"
     gene            <1..>1203
                     /locus_tag="AFUA_1G14390"
                     /old_locus_tag="Afu1g14390"
                     /db_xref="GeneID:3509820"
     CDS             1..1203
                     /locus_tag="AFUA_1G14390"
                     /old_locus_tag="Afu1g14390"
                     /EC_number="1.1.1.14"
                     /note="encoded by transcript AFUA_1G14390A;
                     similar to Sorbitol dehydrogenase (EC 1.1.1.14) (L-iditol
                     2-dehydrogenase). (Swiss-Prot:P27867) [Rattus norvegicus]"
                     /codon_start=1
                     /product="zinc-dependent alcohol dehydrogenase, putative"
                     /protein_id="XP_752809.1"
                     /db_xref="GeneID:3509820"
                     /translation="
MTTTTTTTALVLHGAKDLRLESRPISPPTGSEVQVAIRATGLCGSDLHYYNHGRNGDFVVREPMCLGHESSGTVTAVGPDVTTLQVGDRVALEVGLPCRTCTLCRTGRYNICPDMKFRSSAKLFPHLDGTLMELTNHPADLCHKLPESVSYAGGALVEPLAVCLHAIRRSHPPTPAEVDLATEQGDQTAALIFGAGAIGLLLAAALATSQPFTSIVIADIDPARLEIAKSLNLGLKTHLLPKGGNAANPPPAPDASAAEHAAYAMQNAQRTAAALKEANGVASGFVRVYECTGVPACVQAGIYAASPGAVLVQIGMGNPIQTLPVSAAALREVDIIGTFRYDGHAYPAAIELMASGKLDHVEKQVVTHRVRLEDGSRAFALAGKGVDETGRPVVKVVIES"
     misc_feature    25..1197
                     /locus_tag="AFUA_1G14390"
                     /old_locus_tag="Afu1g14390"
                     /note="Sorbitol dehydrogenase; Region: sorbitol_DH;
                     cd05285"
                     /db_xref="CDD:176188"
     misc_feature    order(127..129,133..135,145..147,163..165,172..174,
                     202..204,349..351,358..360,472..474,946..948,1015..1020)
                     /locus_tag="AFUA_1G14390"
                     /note="inhibitor binding site [active]"
                     /db_xref="CDD:176188"
     misc_feature    order(127..129,133..135,202..207,472..474)
                     /locus_tag="AFUA_1G14390"
                     /note="catalytic Zn binding site [ion binding]; other
                     site"
                     /db_xref="CDD:176188"
     misc_feature    order(292..294,301..303,310..312,334..336)
                     /locus_tag="AFUA_1G14390"
                     /note="structural Zn binding site [ion binding]; other
                     site"
                     /db_xref="CDD:176188"
     misc_feature    order(484..486,532..534,652..660,670..672,787..789,
                     871..876,880..882,940..948,1012..1020)
                     /locus_tag="AFUA_1G14390"
                     /note="NADP binding site [chemical binding]; other site"
                     /db_xref="CDD:176188"
     misc_feature    order(490..492,526..528,565..567,574..582,637..639,
                     664..666,721..723,829..831,1042..1044,1051..1056,
                     1063..1065)
                     /locus_tag="AFUA_1G14390"
                     /note="tetramer interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:176188"
ORIGIN      
atgaccaccacaaccaccacaacagcactcgtcctccatggagccaaagatctccgcctggaatcacgacccatctctcctcccaccggctccgaagtccaagttgccatccgcgcaaccggtctctgcggctcagaccttcactactacaaccacggccgcaatggcgacttcgtcgtgcgcgagccgatgtgcctgggccacgaatcctccggcaccgtcacagctgtcggaccagacgtgacaaccctgcaggtcggcgaccgcgtcgccctcgaggtcggcctcccttgccgtacctgcaccctctgccgcactggccgctacaacatctgcccggacatgaagttccgcagcagcgctaagctcttcccccatctcgacggcaccctcatggaactcaccaaccaccccgccgatctctgccacaagcttcctgagagtgtctcctacgccggcggcgccctcgtcgagcccctcgctgtctgcctgcacgccatccgccgctcgcacccgcccacccccgccgaagtggatctggccaccgaacagggcgaccagaccgccgcgctgatcttcggcgcaggagccatcggcctcctcctcgccgctgcactagccacctcccagcccttcacctccatcgtcatcgcggacatcgaccccgcccgtctcgagatcgcaaaatccctcaacctaggcctgaagacccatctcctccccaagggcggcaatgccgccaacccaccccctgcgccggacgcctctgccgcagagcatgccgcgtacgccatgcagaatgcgcagcggaccgcagcggcgctgaaagaggcgaatggggttgcgtcagggtttgtgcgcgtgtacgagtgtaccggcgtgccggcgtgcgtgcaggcggggatctacgctgccagccctggcgccgtgctcgtgcagatcgggatggggaatccgattcagacgcttccggtgagtgcggcggcgctccgggaggtggatatcatcggcacgttccggtatgatggccatgcgtacccggctgcaattgagttgatggctagtgggaagcttgaccatgtcgagaagcaggttgttacgcatcgcgtcagacttgaggatgggagtcgggcgtttgcgctggcggggaagggagtggatgagactggcaggccggtggtcaaggtcgtcattgagagctag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]