LOCUS       XM_077173725            4441 bp    mRNA    linear   VRT 25-SEP-2025
DEFINITION  PREDICTED: Agelaius phoeniceus ATPase copper transporting beta
            (ATP7B), transcript variant X5, mRNA.
ACCESSION   XM_077173725
VERSION     XM_077173725.1
DBLINK      BioProject: PRJNA1331850
KEYWORDS    RefSeq.
SOURCE      Agelaius phoeniceus (red-winged blackbird)
  ORGANISM  Agelaius phoeniceus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Australaves;
            Passeriformes; Passeroidea; Icteridae; Agelaius.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135266) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_051311805.1-RS_2025_09
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/22/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..4441
                     /organism="Agelaius phoeniceus"
                     /mol_type="mRNA"
                     /isolate="bAgePho1"
                     /db_xref="taxon:39638"
                     /chromosome="2"
                     /sex="female"
                     /tissue_type="blood"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Millbrook, New York"
                     /lat_lon="41.775839 N 73.744242 W"
                     /collection_date="2020-06-05"
                     /collected_by="Melanie Couture, Jean-Nicolas Audet"
     gene            1..4441
                     /gene="ATP7B"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 2 Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments, including 6 samples with
                     support for all annotated introns"
                     /db_xref="GeneID:129134662"
     CDS             296..4282
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X4"
                     /protein_id="XP_077029840.1"
                     /db_xref="GeneID:129134662"
                     /translation="

MERKLDNKMKRELSYLATLNDRNISLVSIRKQQAARDVPELLIIGEKSKTASPVKASSNLQKEEKLLQSYSMGMTEVNTDERQALSNIVSPPGCELKPTMKHNFAFDNIGYEASSETMPSPPSQEHTVVVNIVGMTCQSCVQSIEGRISKVNGILRIKVSLEQNNAVIKYRRSEISPEQICQEILDMGFDANIAEEKLTTATVNLPSLKEAVAKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLDNQEAIIAYHPYIIQPDDLKRHISDLGYDCTIKSKSAPLKLGALDLQRLQNANPRETPANFGSDGLDPLVPKMGSTATVTVQIEGMHCKSCVRNIEGNISDLPGIKSIKVSLEHKCAVVQYSPDLITLSAFQQAIESLPPGNFKVSLLSGSEANKTASPSGAFTYNVIRQPPQGTTHVAVIKIDGMTCNSCVQSIEGAVSQRQGVKNVVVSLAGSTGTIHYDPTVTSGEELRAAIEDMGFDASVLTDTAPGEHRCQPDASKAAVQPRAPEPPHQGNSSDALPHPDGSNQLSGGTEEKCVLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPELIQPLEIAQLIQNLGFEATIMENNAETEGQVELLITGMTCASCVHNIESKLMRTNGIFSASVALATSKAHIQFDPEIIGPRDIIKVIKEIGFHASVAKRDPNAHNLSHKKEIQQWRKSFLYSLAFGIPVVVLMIYMQIPNGEDHGSKVLEQNLIPGLSILNLLFFILCTFVQFLGGWYFYVQAYKSLRHKTANMDVLIVLATTIAYVYSCVILIVAILEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKGKTSEALAKLMSLQATEATVVTLGPGHSIVREEQVPVELVQRGDIIKVVPGGKFPVDGKVIDGSSMADESLITGEPMPVIKKPGSTVIAGSINAYGSLLVNATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIAWITIGFVNFDIIKKYFPNQSKNISKAEIILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHQIKTVMFDKTGTITYGVPKVMRLLLMGDTAVLPLKKVLAVVGTAEASSEHPLGMAVTKYCKEELGTESLGYCTDFQAVPGCGISCKVGGVEAILGTAEEAPNKLDANRTGNSSAPLGDSGVIPLLESQGPSASQKYSVLIGNREWMRRNGLNIANDVNDAMTNHEMKGQTAILVAIDGALCGMIAIADTVKQEAALAVHTLQSMGIDVVLITGDNRKTAKAIATQVSHHTADSASTVVCTLFCAVRSVLFLHVML"

     misc_feature    680..868
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(698..706,713..715)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    935..1126
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(953..961,968..970)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1259..1447
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1568..1771
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1928..2119
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1946..1954,1961..1963)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2156..2347
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(2174..2182,2189..2191)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2411..>4192
                     /gene="ATP7B"
                     /note="Haloacid Dehalogenase-like Hydrolases; Region:
                     HAD_like; cl21460"
                     /db_xref="CDD:473868"
ORIGIN      

tgcagagatcagcagtgccggacgcagctgggaaggcacgagggatgccgattggtgggaaacatttgaactggcagggagagcaggtagctgagtgcagcaagcagcctacataaggatcacaggttgcatctgggatttcctgatgaatgcctaataagcacatggattagatgggcagaactcttcaagctgttgtaaatgtagctgaaagaagcgtggcttggaggacaacaaataactgctctcgtgaaacttttttttggcattgcaatatttaaagcccagaaaaataatggagagaaaactggacaataaaatgaaaagggaactgtcctacttagctactttaaacgacagaaacatatccttggtgtctattcgtaagcagcaggcagctcgtgatgtgcctgaactactgattattggtgaaaagtccaagacggcatctccggtaaaagcaagcagtaacttgcagaaagaagagaaacttttgcagagttactccatgggaatgacagaagtcaatacagatgaaaggcaggctttgtccaacatcgtttctcctcctggttgtgagctgaagcctacaatgaagcataattttgcttttgacaacataggctatgaggcaagctctgaaaccatgccctctccaccttcccaagagcatactgtggtagtcaacattgtgggaatgacctgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtgaacggcattttgagaattaaagtctcccttgaacagaacaacgctgttatcaagtatcggcggtcggaaataagccctgaacagatttgccaggaaattctggatatgggctttgacgccaacatagctgaagagaagttgacaacagcaactgtaaatttgccaagcttgaaagaagcagtagctaagcttcgggtagaaggcatgacatgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcacggtgtggcaaaaatcaaggtgtcacttgataaccaagaagcaattattgcttaccatccttacatcattcagcctgatgacctcaagagacacatcagtgacctggggtacgactgcaccattaaaagtaaatcagcccctttgaagctgggtgcccttgatctccagcgcttgcagaatgcaaaccccagggagacacccgcaaattttgggagtgatgggctggatccactggtccccaagatgggtagcacagcaacagtgactgtacagatagagggcatgcactgcaagtcctgtgtcagaaacatcgaaggaaatatatcagatcttcctggcataaaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtacagcccagatttaatcaccctgtcagctttccagcaagctatcgaatcccttccacctggaaactttaaagtgagcctccttagtggttcagaagcaaataaaacagcatctccctcaggtgctttcacatacaatgtcatcagacagccaccacaaggcacgacacatgtggctgttattaagattgatggcatgacctgcaattcttgtgtccagtccatagaaggggctgtatcacagaggcagggagtgaagaatgtagtagtttctctagctggcagtactgggaccatacactatgatccaactgtcactagtggagaagagttaagagctgccatagaagacatgggatttgatgcctctgtgctgacagacaccgcccctggagaacacaggtgccagcctgatgccagcaaagctgctgtgcagcctcgagctccagagcctcctcaccaaggcaattcctcagatgctcttcctcaccctgatgggtcaaaccagctcagtggaggcacagaagaaaagtgtgttttgcagatcacaggcatgacctgtgcatcgtgtgtgtctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttagtagcactgatggcaggtaaagcagagataaaatacaagccagaactcatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccatcatggaaaataatgcagaaacagaagggcaagtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatccaaactcatgagaacaaatggcatattctctgcctcagttgcacttgcaactagcaaagctcacatccagtttgatcctgaaattattggacctcgagatattataaaagtaatcaaggaaattggctttcatgcttctgtggctaaaagagatccaaatgcacataacctgagtcataaaaaggaaatacagcagtggaggaaatctttcttgtacagcctagcatttggtatccctgttgtagtcttaatgatttatatgcaaatacccaatggtgaagaccatgggtctaaggtcctggaacagaacctcattcctggattatctattttgaatcttctcttttttatcctgtgcacttttgttcagttccttggtggatggtatttttacgtgcaagcttacaagtccctgaggcacaagacagccaatatggatgtgctcatcgtgctggccacgacgattgcttatgtgtattcctgcgtgatcctgatagtagcaatccttgaaaaggcagagaaaagccctgtcactttcttcgacactcctcccatgttgtttgtgttcattgcgctcggcagatggctggaacacatagccaagggcaagacctcagaagctcttgctaagcttatgtctcttcaagccacagaagccactgtggtgacccttggacctggccactctattgtcagggaggagcaagtacctgttgaactggttcaaaggggtgatattataaaagttgttcctggtggaaagttcccagtggatggaaaggtcattgacggcagttctatggcagatgagtctctcattactggggaacctatgccagtcattaaaaagcctgggagcacagtgattgctggttctataaatgcatatggctcacttcttgttaatgcaactcatgttggtagtgataccactctggcacagattgtaaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataaatttagtggatactttgttccatttatcatcatcatttcaactgtgacattgatagcatggatcacaattggttttgtaaactttgatattattaaaaaatattttcctaatcagagcaaaaacatttcaaaagctgaaataatactgaggtttgcattccaaacctcaatcactgtgctgagcattgcatgcccttgctctttaggcctggctacccccacagctgtaatggtgggcacaggagtggctgcgcagaatggaattctcatcaaaggtggaaaacccctggaaatggcacatcagatcaagactgtgatgtttgataaaacggggaccatcacctatggagttcctaaagtcatgaggctgcttttgatgggagacacagctgtgctccccctgaagaaagtgctggctgttgttggtacagcagaggccagcagcgagcatcctttaggaatggctgtcactaaatactgcaaagaggagcttggcactgagagcctgggatactgcaccgacttccaggcagtcccaggctgtggtatcagctgcaaggttggaggagttgaggccatccttggcacagctgaggaagctcccaataagctggatgctaacaggactgggaacagcagcgctcctctgggagatagtggagttatcccactcttggaatcacaaggtccatcagcttctcagaaatactcggtgttgatcggaaatcgtgagtggatgcgacgcaatggcttgaatattgcaaatgatgtaaatgatgcaatgacaaaccatgaaatgaaaggacagactgccatactagtggctatagatggtgcattgtgtggaatgattgccatagcagacactgtcaagcaggaggcagcccttgctgtgcacacactgcagagcatgggaatagacgtggtgctcataacaggggacaacaggaaaactgcaaaagccattgctactcaggtatcccaccacacagctgactcagccagcactgtggtatgcacgctcttctgtgctgtgaggtctgttttgtttctccatgtgatgctttaatcctcctcctattggctttcacactttcgctttcgtgttcagttatgttaaagtgctttcccacctaattttctttgtcaagggaaaaaagtcttttagaaacaagcttgaatttatggttccaggaacagagatgaatgttttaaacaagcttatttt

//