ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-05-31 02:56:44, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_077158145 4792 bp mRNA linear MAM 24-SEP-2025
DEFINITION PREDICTED: Tamandua tetradactyla ATPase copper transporting beta
(ATP7B), transcript variant X5, mRNA.
ACCESSION XM_077158145
VERSION XM_077158145.1
DBLINK BioProject: PRJNA1331809
KEYWORDS RefSeq.
SOURCE Tamandua tetradactyla (southern tamandua)
ORGANISM Tamandua tetradactyla
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Xenarthra; Pilosa; Vermilingua;
Myrmecophagidae; Tamandua.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_135330) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_023851605.1-RS_2025_09
Annotation Pipeline :: NCBI Eukaryotic Genome Annotation
Pipeline (EGAP)
Annotation Software Version :: 10.5
Annotation Method :: Gnomon; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 09/22/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..4792
/organism="Tamandua tetradactyla"
/mol_type="mRNA"
/isolate="mTamTet1"
/isolation_source="zoo speciman"
/db_xref="taxon:48850"
/chromosome="4"
/sex="male"
/tissue_type="spleen"
/dev_stage="adult"
/geo_loc_name="Guyana"
/lat_lon="4.917311 N 58.943462 W"
/collection_date="2017-01-02"
/collected_by="Gudrun Wibbelt"
gene 1..4792
/gene="ATP7B"
/note="ATPase copper transporting beta; Derived by
automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 1 Protein, and 100% coverage of the annotated genomic
feature by RNAseq alignments, including 1 sample with
support for all annotated introns"
/db_xref="GeneID:143681262"
CDS 324..4544
/gene="ATP7B"
/codon_start=1
/product="copper-transporting ATPase 2 isoform X4"
/protein_id="XP_077014260.1"
/db_xref="GeneID:143681262"
/translation="
MEKAEAPPGPGQSLLATLSDPSVTLLSAHKRESSRRSPGARGSAGPMCLEEEGPFPSEQGDFSQRVLNGMRELSSHQISSKLPWPAHSWEPARKQRFAFDNVGFEGSLDSMHPSQTATGTISILGMTCQSCVKSVEDRVSSMDGIVAIRVSLDQGRATVSYMPSAVGLQEVCRQIEDLGYESSIMEGKPASWPSRSSPAGEAMVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLSTQEAVVTYQPYLIQPEDLRDQLSDMGFEATIKNKTAPLSLGPIDIVRLQNANPKRPLASAHQSFNNSETREEPGHHMVTMQLSVDGMHCKSCVLNIEENIGQLPGVQSIQVSLENRTAQVQFDPACVSPVSLQEAIEALPPGNFKVSLPERAEGSGLERLPDPRVSDRHVSSSPRGPRAPGASRSVVLVVANMTCASCVRAVKNVISQREGVQRVFISTAEGTVTVFYKPSATSPEELRAAVEDMGFEASVLSEDAPFSHVENHSVGTSPVQTTEDVAAAVQEVAPQAGGTPVNHSPSHSPKSPAASATLPLQKCFLQITGMTCASCVSNIERNLQKEAGIVSVLVALMAGKAEVKYNPEIIQPLEIAQLIQKLGFDATVMEDHTSSDGHIELIITGMTCASCVHNIESKLMRTEGVTYASVALATSKAHVRFDPEIIGPRDVVKIIEEIGFHASLAQRDPNAHHLDHRLEIKQWKKSFLCSLVFGIPVMGLMVYMLIPGPEPHEAMVLDRNIVPGLSILNLIFFVLCTFVQFLGGWYFYVQAYRSLRHRTANMDVLIVLATSIAYAYSLVILVVAVAEQAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDVIKVMPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVHATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPIPSKHISRAELTLRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQHGVLIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRFLLLMETAALPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGAETLGYCTDFQAVPGCGIGCKVSNVEGLLVHERPLNEQAVSVPTEKDVTPQTFSVLIGNREWMRRNGLTISSDVGDAMTDHEMKGQTAILVAINGVLCGMIAIADTVKQEAALAVHTLKDMGVDVVLITGDNWRTARAIATQVGIRKVFAEVLPSHKVAKVQELQDRGQKVAMVGDGVNDSPALVQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAEPWTPLGHSP"
misc_feature 681..881
/gene="ATP7B"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 936..1127
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(954..962,969..971)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1278..1454
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1296..1304,1311..1313)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1596..1787
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1614..1622,1629..1631)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1986..2174
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(2001..2009,2016..2018)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 2211..2402
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(2229..2237,2244..2246)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 2466..4541
/gene="ATP7B"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(3459..3461,3465..3467,4482..4484)
/gene="ATP7B"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(3591..3599,3801..3803,3933..3941,4029..4031,
4149..4157,4215..4217,4224..4226,4233..4235,4290..4292,
4299..4301)
/gene="ATP7B"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
ORIGIN
ccaggctggctctctgggagcggccaccacacagggccaagaggaaactgcatttcagcatccagatatctgggtgctgggctctcgtgcgtgctggcaggcgagtccccggcagcggtgtgcgggccgtgtgcaaagataacggggggtgagtgaaagggtgaagagtgcaacaaggcagagcaagtgcacgcgccgtgcagggtggcccacacacatacctggagcttgctgctgggctgaagacctgcaaaggaggacctttcagagcccacaaggttgggcctgtaccgggggaaggtgaacgcgggagggcagccgtgatggagaaagccgaggcgcccccaggcccagggcagtctttgctggcgacactgagcgatccaagtgtgaccctgctgtctgcccacaagcgggagtcctccaggaggagcccaggggccaggggctcggccgggcccatgtgtttggaagaggaaggccctttcccatcagagcagggagacttttcccagagggttttgaatggaatgcgggagctcagttcccatcagatttcatctaaacttccttggcctgctcactcctgggaaccagcaaggaagcaacgctttgcctttgacaatgttggcttcgaaggtagcctggacagcatgcacccttcccagacagcaactggcaccatcagcattttgggcatgacttgccagtcatgtgtgaaatctgtcgaggacagggtttccagcatggacggcatcgtggccattagggtttctctggaccagggccgtgcaaccgtgagctacatgccatcggccgttggcctccaggaggtttgccgtcaaattgaagatctgggctacgagtccagcatcatggaaggaaagcctgcctcctggccctcccggtcctcacctgccggggaagcaatggtcaagctccgggtagaaggcatgacctgccagtcctgtgtcagctccattgagggcaagattgggaaactgcaaggagtggtgcgagtccgagtctcactcagcacccaggaggcagtggtcacttatcagccttaccttatccagcccgaagacctcagggaccagttaagtgacatgggatttgaagccaccatcaagaacaaaacggctcccttaagcctgggaccaattgatatagtgcggttacaaaacgcaaacccaaagagacctttggcttctgctcaccagagtttcaataattctgagacccgagaagagccaggacaccacatggtcaccatgcaactgagcgtagatggaatgcactgtaaatcttgtgtcttgaatatcgaagaaaatataggccaactccctggggttcagagtatccaggtgtctctggagaacagaactgcccaagtacagtttgaccctgcttgtgtctccccagtgtccctgcaggaggccatcgaggctcttccacctgggaactttaaagtttctcttcctgaaagagcagaagggagtggactggaacgcctgccagaccccagggtttctgatcgccatgtttccagttcccctcggggcccccgggcaccaggagcgagcagatcagtggtgctagtggttgcaaacatgacctgtgcctcctgtgtccgggctgtcaagaacgtgatctcccagagggaaggggtgcagagagtgttcatctccacggctgaagggacagttaccgttttctataagccctctgcaactagcccagaagagctcagagctgctgtagaagacatgggatttgaggcttcagtcctttctgaagacgctcctttcagccatgttgaaaaccatagcgttgggacttccccagtgcagactacagaggatgtggctgcagccgtgcaggaagtggctccccaagctgggggcacccctgtaaaccacagccccagccactcacccaagtctccagcggcctccgcaacacttccactgcagaagtgctttctgcagatcacaggcatgacctgtgcgtcctgcgtgtccaacatagagcggaatctgcagaaggaagctggcattgtttctgtgctggttgccttgatggcaggaaaggcagaagtcaaatataatcctgaaatcatacagccacttgaaatagctcagctcatccagaaactgggctttgatgcaacagtcatggaagaccacacgagctcagacggccacatcgagctgattatcacggggatgacctgtgcatcctgtgtccataacatagagtccaagctcatgcggacagaaggcgtcacctatgcctcagtggcccttgccaccagcaaagcccatgtgaggtttgatcctgagattatcggtccacgggatgttgtcaaaattattgaggaaattggctttcatgcttctttggcccagagggaccccaacgctcatcacttggaccacaggctggaaataaagcagtggaagaagtccttcctgtgtagcttggtgttcggcatcccggtcatgggcttgatggtctacatgctgatacccggccccgagccgcacgaggccatggtcttggaccgcaacatcgttccaggactgtccatcctgaacctcatcttcttcgtcttgtgcacctttgtccagttcctcggcggctggtacttctacgtccaggcgtacaggtccctgcggcacaggacggccaacatggacgtgctcatcgtgctggccacctccatcgcctacgcctactccctggtgatcttggtggtggccgtggccgagcaggctgagaggagccccgtgaccttctttgacacgccccccatgctcttcgtgttcattgccctggggcgatggctggaacacgtggcaaagagcaaaacctcagaggctcttgccaaactcatgtctctccaagccacagaagccactgttgtgacccttggtgaggacaacttaatcatcagagaggagcaggtgcccatggagctggtgcagcgcggggacgtcatcaaggtcatgcccgggggcaagttcccggtggacgggaaagtcctggaaggcaacaccatggccgacgagtccctcatcacaggggaggccatgcctgtcacgaagaagcccggcagcaccgtcatcgccgggtccatcaacgcgcacggctctgtgcttgttcacgccacccatgtgggcagcgacaccacgctggcccagatcgtgaagctggtggaggaggctcagatgtccaaggcacccattcagcaacttgctgaccgatttagtggatattttgtcccctttatcatcatcatttcaactttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcccatccccagcaagcacatctcccgggctgagctgaccctccggttcgccttccagacgtccatcacagtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacagcggtcatggtgggaaccggggtggccgcccagcatggcgtcctcatcaagggcggcaagcctctggagatggcacacaagataaagactgtgatgtttgacaaaactggcaccattacccacggggtccccaaagtaatgcgtttcctgctgcttatggagacagccgcactgcctctcaggaaggttcttgctgtggtcgggactgcagaggccagcagcgaacaccccttgggcgtggcagtcaccaaatactgtaaagaggaactcggagcagaaaccttggggtactgcacggacttccaggcggtcccaggctgcggaatcggctgtaaagtcagcaatgtggaaggcctcctggtccacgagcggcctctgaacgaacaggccgtcagtgtgcccaccgagaaagacgtcaccccccagaccttctctgtgctgattggaaaccgcgagtggatgcggcgcaacggtttgaccatttccagtgatgtcggtgacgccatgaccgatcacgaaatgaagggacagacagccatcctggtggccatcaacggtgtcctctgcgggatgattgcgatcgcggacaccgtcaagcaggaggcggccctggctgtgcacacgctgaaggacatgggtgtggatgtggtgctcatcacaggggacaactggaggacagccagagccattgccacccaggtcggcatccgcaaagtgtttgcagaggtgctgccctcgcacaaggtggccaaggtccaggagctccaggacagagggcagaaggttgccatggtgggcgacggggtgaacgactccccagccctcgtgcaggcggacgtgggcatcgccattgggacaggcacggacgtggccatcgaggcggcagacgtggtcctcatcagaaacgacttactcgacgtggtggccagcatccacctttccaagaggaccgtccgcagaatacgcatcaatctggtcctggcattgatttacaacctgctggggatacccatcgcggcagagccctggacacctcttggccattctccgtgaaatgggtggtgccatctgtgggaagtttcaggaagctcagggtaggtagaaccctaagtagagcagagtccattctgccccacagcctcaccccagagcatggaggcctgtgagcacgtgtccccgccctgccagcagcagcctccaggccacccgagagggacactgggcagcgagggctgggcccaggtctggccctgcaggccacttgcccacaccctcctctgctctggacagtgtgagtgggt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]