LOCUS       XM_077158144            6920 bp    mRNA    linear   MAM 24-SEP-2025
DEFINITION  PREDICTED: Tamandua tetradactyla ATPase copper transporting beta
            (ATP7B), transcript variant X4, mRNA.
ACCESSION   XM_077158144
VERSION     XM_077158144.1
DBLINK      BioProject: PRJNA1331809
KEYWORDS    RefSeq.
SOURCE      Tamandua tetradactyla (southern tamandua)
  ORGANISM  Tamandua tetradactyla
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Xenarthra; Pilosa; Vermilingua;
            Myrmecophagidae; Tamandua.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135330) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_023851605.1-RS_2025_09
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/22/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6920
                     /organism="Tamandua tetradactyla"
                     /mol_type="mRNA"
                     /isolate="mTamTet1"
                     /isolation_source="zoo speciman"
                     /db_xref="taxon:48850"
                     /chromosome="4"
                     /sex="male"
                     /tissue_type="spleen"
                     /dev_stage="adult"
                     /geo_loc_name="Guyana"
                     /lat_lon="4.917311 N 58.943462 W"
                     /collection_date="2017-01-02"
                     /collected_by="Gudrun Wibbelt"
     gene            1..6920
                     /gene="ATP7B"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 12 Proteins, and 100% coverage of the annotated
                     genomic feature by RNAseq alignments, including 3 samples
                     with support for all annotated introns"
                     /db_xref="GeneID:143681262"
     CDS             143..4525
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X3"
                     /protein_id="XP_077014259.1"
                     /db_xref="GeneID:143681262"
                     /translation="

MMPGQEGLISAREGARRKISSKLPWPAHSWEPARKQRFAFDNVGFEGSLDSMHPSQTATGTISILGMTCQSCVKSVEDRVSSMDGIVAIRVSLDQGRATVSYMPSAVGLQEVCRQIEDLGYESSIMEGKPASWPSRSSPAGEAMVKLRVEGMTCQSCVSSIEGKIGKLQGVVRVRVSLSTQEAVVTYQPYLIQPEDLRDQLSDMGFEATIKNKTAPLSLGPIDIVRLQNANPKRPLASAHQSFNNSETREEPGHHMVTMQLSVDGMHCKSCVLNIEENIGQLPGVQSIQVSLENRTAQVQFDPACVSPVSLQEAIEALPPGNFKVSLPERAEGSGLERLPDPRVSDRHVSSSPRGPRAPGASRSVVLVVANMTCASCVRAVKNVISQREGVQRVFISTAEGTVTVFYKPSATSPEELRAAVEDMGFEASVLSEDAPFSHVENHSVGTSPVQTTEDVAAAVQEVAPQAGGTPVNHSPSHSPKSPAASATLPLQKCFLQITGMTCASCVSNIERNLQKEAGIVSVLVALMAGKAEVKYNPEIIQPLEIAQLIQKLGFDATVMEDHTSSDGHIELIITGMTCASCVHNIESKLMRTEGVTYASVALATSKAHVRFDPEIIGPRDVVKIIEEIGFHASLAQRDPNAHHLDHRLEIKQWKKSFLCSLVFGIPVMGLMVYMLIPGPEPHEAMVLDRNIVPGLSILNLIFFVLCTFVQFLGGWYFYVQAYRSLRHRTANMDVLIVLATSIAYAYSLVILVVAVAEQAERSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDVIKVMPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVHATHVGSDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVVWIIIGFIDFGVVQKYFPIPSKHISRAELTLRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQHGVLIKGGKPLEMAHKIKTVMFDKTGTITHGVPKVMRFLLLMETAALPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGAETLGYCTDFQAVPGCGIGCKVSNVEGLLVHERPLNEQAVSVPTEKDVTPQTFSVLIGNREWMRRNGLTISSDVGDAMTDHEMKGQTAILVAINGVLCGMIAIADTVKQEAALAVHTLKDMGVDVVLITGDNWRTARAIATQVGIRKVFAEVLPSHKVAKVQELQDRGQKVAMVGDGVNDSPALVQADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLVLALIYNLLGIPIAAGVFMPFGIVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPELERDEAQGRMKPLSASQVSVHIGMDDRRWDSPRATPWDQVSYVSHVSLSSLTSDRLSRHSAPADDGGDKWSLLLSDRDEEQYI"

     misc_feature    323..523
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    578..769
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(596..604,611..613)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    920..1096
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(938..946,953..955)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1238..1429
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1256..1264,1271..1273)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1628..1816
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1643..1651,1658..1660)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1853..2044
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1871..1879,1886..1888)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    2108..4195
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(3101..3103,3107..3109,4124..4126)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(3233..3241,3443..3445,3575..3583,3671..3673,
                     3791..3799,3857..3859,3866..3868,3875..3877,3932..3934,
                     3941..3943)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

gccttggaggcgcgctaaggcatccaggccccatcccgccgccccggaggccaatgggaggccctcgcgcgacccagatcgattttccaggtgacctttgggctctgggccgaactagagaaggaactggttccgctgagggatgatgcctgggcaggaaggactgataagtgctagagaaggagcacgtcggaagatttcatctaaacttccttggcctgctcactcctgggaaccagcaaggaagcaacgctttgcctttgacaatgttggcttcgaaggtagcctggacagcatgcacccttcccagacagcaactggcaccatcagcattttgggcatgacttgccagtcatgtgtgaaatctgtcgaggacagggtttccagcatggacggcatcgtggccattagggtttctctggaccagggccgtgcaaccgtgagctacatgccatcggccgttggcctccaggaggtttgccgtcaaattgaagatctgggctacgagtccagcatcatggaaggaaagcctgcctcctggccctcccggtcctcacctgccggggaagcaatggtcaagctccgggtagaaggcatgacctgccagtcctgtgtcagctccattgagggcaagattgggaaactgcaaggagtggtgcgagtccgagtctcactcagcacccaggaggcagtggtcacttatcagccttaccttatccagcccgaagacctcagggaccagttaagtgacatgggatttgaagccaccatcaagaacaaaacggctcccttaagcctgggaccaattgatatagtgcggttacaaaacgcaaacccaaagagacctttggcttctgctcaccagagtttcaataattctgagacccgagaagagccaggacaccacatggtcaccatgcaactgagcgtagatggaatgcactgtaaatcttgtgtcttgaatatcgaagaaaatataggccaactccctggggttcagagtatccaggtgtctctggagaacagaactgcccaagtacagtttgaccctgcttgtgtctccccagtgtccctgcaggaggccatcgaggctcttccacctgggaactttaaagtttctcttcctgaaagagcagaagggagtggactggaacgcctgccagaccccagggtttctgatcgccatgtttccagttcccctcggggcccccgggcaccaggagcgagcagatcagtggtgctagtggttgcaaacatgacctgtgcctcctgtgtccgggctgtcaagaacgtgatctcccagagggaaggggtgcagagagtgttcatctccacggctgaagggacagttaccgttttctataagccctctgcaactagcccagaagagctcagagctgctgtagaagacatgggatttgaggcttcagtcctttctgaagacgctcctttcagccatgttgaaaaccatagcgttgggacttccccagtgcagactacagaggatgtggctgcagccgtgcaggaagtggctccccaagctgggggcacccctgtaaaccacagccccagccactcacccaagtctccagcggcctccgcaacacttccactgcagaagtgctttctgcagatcacaggcatgacctgtgcgtcctgcgtgtccaacatagagcggaatctgcagaaggaagctggcattgtttctgtgctggttgccttgatggcaggaaaggcagaagtcaaatataatcctgaaatcatacagccacttgaaatagctcagctcatccagaaactgggctttgatgcaacagtcatggaagaccacacgagctcagacggccacatcgagctgattatcacggggatgacctgtgcatcctgtgtccataacatagagtccaagctcatgcggacagaaggcgtcacctatgcctcagtggcccttgccaccagcaaagcccatgtgaggtttgatcctgagattatcggtccacgggatgttgtcaaaattattgaggaaattggctttcatgcttctttggcccagagggaccccaacgctcatcacttggaccacaggctggaaataaagcagtggaagaagtccttcctgtgtagcttggtgttcggcatcccggtcatgggcttgatggtctacatgctgatacccggccccgagccgcacgaggccatggtcttggaccgcaacatcgttccaggactgtccatcctgaacctcatcttcttcgtcttgtgcacctttgtccagttcctcggcggctggtacttctacgtccaggcgtacaggtccctgcggcacaggacggccaacatggacgtgctcatcgtgctggccacctccatcgcctacgcctactccctggtgatcttggtggtggccgtggccgagcaggctgagaggagccccgtgaccttctttgacacgccccccatgctcttcgtgttcattgccctggggcgatggctggaacacgtggcaaagagcaaaacctcagaggctcttgccaaactcatgtctctccaagccacagaagccactgttgtgacccttggtgaggacaacttaatcatcagagaggagcaggtgcccatggagctggtgcagcgcggggacgtcatcaaggtcatgcccgggggcaagttcccggtggacgggaaagtcctggaaggcaacaccatggccgacgagtccctcatcacaggggaggccatgcctgtcacgaagaagcccggcagcaccgtcatcgccgggtccatcaacgcgcacggctctgtgcttgttcacgccacccatgtgggcagcgacaccacgctggcccagatcgtgaagctggtggaggaggctcagatgtccaaggcacccattcagcaacttgctgaccgatttagtggatattttgtcccctttatcatcatcatttcaactttgacgttggtggtatggattataatcggttttatcgattttggtgttgttcagaaatactttcccatccccagcaagcacatctcccgggctgagctgaccctccggttcgccttccagacgtccatcacagtgctgtgcatcgcctgcccctgctccctgggcctggccacgcccacagcggtcatggtgggaaccggggtggccgcccagcatggcgtcctcatcaagggcggcaagcctctggagatggcacacaagataaagactgtgatgtttgacaaaactggcaccattacccacggggtccccaaagtaatgcgtttcctgctgcttatggagacagccgcactgcctctcaggaaggttcttgctgtggtcgggactgcagaggccagcagcgaacaccccttgggcgtggcagtcaccaaatactgtaaagaggaactcggagcagaaaccttggggtactgcacggacttccaggcggtcccaggctgcggaatcggctgtaaagtcagcaatgtggaaggcctcctggtccacgagcggcctctgaacgaacaggccgtcagtgtgcccaccgagaaagacgtcaccccccagaccttctctgtgctgattggaaaccgcgagtggatgcggcgcaacggtttgaccatttccagtgatgtcggtgacgccatgaccgatcacgaaatgaagggacagacagccatcctggtggccatcaacggtgtcctctgcgggatgattgcgatcgcggacaccgtcaagcaggaggcggccctggctgtgcacacgctgaaggacatgggtgtggatgtggtgctcatcacaggggacaactggaggacagccagagccattgccacccaggtcggcatccgcaaagtgtttgcagaggtgctgccctcgcacaaggtggccaaggtccaggagctccaggacagagggcagaaggttgccatggtgggcgacggggtgaacgactccccagccctcgtgcaggcggacgtgggcatcgccattgggacaggcacggacgtggccatcgaggcggcagacgtggtcctcatcagaaacgacttactcgacgtggtggccagcatccacctttccaagaggaccgtccgcagaatacgcatcaatctggtcctggcattgatttacaacctgctggggatacccatcgcggcaggtgtcttcatgcccttcggcatcgtactgcagccctggatgggctctgcagccatggcggcctcctccgtttctgtggtgctttcgtccctgcagctgaagtgctataagaagccggagctggagagggatgaggcccagggccgcatgaagccgctgagcgcatcccaggtcagcgtgcacatcggcatggatgaccggcggtgggactcccctcgggccacaccgtgggatcaggtcagctacgtcagccatgtgtctctgtcctccctgacgtcggacaggctgtcccggcacagtgccccggctgatgacggtggggacaagtggtctctgctcctgagtgacagggatgaggagcagtacatctgagctcaggcgggtacagagtcactgtgagggcagtgccacatctcccaggcaagtagccagctctgcctgccagagggtgcctaagggagaagattcgtccatttgctgcgattgagttgaacaggggcagccacagctagcagcaccagggttgacagccatcatctctactcagccctccctgcagcactcagccttctccagatggagccaacaccagcctgtaggactggcctcccaaggtgctgtgtgcagcagaagagacttctgacctcatccatgacgttggcatgagcttcacctgaagccgtgctctgacctgaagaggagagtcccccccaccccgcccccgccctgtggacctgtgcttttcatattggggatgactgctttgtgaaacgaggaaaccttgtcaggaccaaaagcttaaggagccttcccatagagttcatagaaaactcagtggtgggctcttttctatgacgcctgtgtgcattgcagagaccacagtttacctcaagggcgagtattgttttctgctggcacaatctcttctttcctccccttctgtttgcttggagtccttgacactgcagattgtcatctttgagggctggactgatgtcctcacggccccagtgctgctttttccaaatgcgttcggcttgtgcacttcctgcctgaatctgttccttggcacctacacattgtgccggagggctggtcatgtctctcttcacatcaagaattccttttcagttatagtctgcttatccatgaagtcctgactttctcctcttagggaatagagttctgttgctgaccagctgagttggggtctcagagtccaagacaggcgtcctaaattctggcttcctgtggggtctgagatgtactcatttggtatctgtaggaggcctgcacgatgtgtggggggatgtggggggcagggagaggtgcagggatacctccctcctgggcttcaggagctgcagtcagttgtattccatgtgactctctcccctggagtccaggggagaatacgatatcagtggctcctgtccccaggttgtaagacttggaaagcagtaatgttggataagagtaaatcatagttctcttccatgaaacttctacttccacgcactgcgttggtgaccacaacttcccaaagggcaagtctgttattaattttcagtggctctttgtggttgggtggcaccagagaggtaaaagttttagggccttaagtcagctggtgattgacagcctaggagagactgaggttaaattttaaggcaaagcccttgtcacacagaataattttatttatttattaagtgtcaattatttgccaggtgcagtgtaagcactttttataagttacctctaatctcaaataaaccagcaaggtagatattgttgtcccattttacaggtgagaaaactgagactcagggaggctaagtatcttctctcacttatcagccagtaaccacgccgaatagggattcaaatccaatctttgccctgaagtcttttctcttagaacaaaattctaggtgatttattagttaagttgactttgattggaatttgatcctgatgtcaacttaccttcaacttggatggttagtttgttttttttgcatataatttcatttttgctgaatttttatcctccaaaacctaaatgtagagttttgggattgttttgttttcagtcttcttttccttcccagccccttccccatcccatccctgttgtgtcctctatttattttctgacatgcttggggaatgcttctttatttcctaacttggctaattattgctgtctcaaaaatctaattgtaccaaattttcaaaaaaacttttaggaacataaacattgtgtttatatgaacttgaaagtatttatataattataatgaaaataaccttttaaatgttcaaagtgtaaggatttggggttttttttctttttggtagaataagaacattttctatttcaaaacttttcatgcaatgttaaaataaagtttcttcctgttttgcattctacatctgcatttggttttctgtctgtgaaagagaagcacggtcaggggccccccatctcctcccccttcagtgagcccttctgcaaagcacaggctttgcttaattccttcttggagcagagaagaatgggatttaatgttggagggtgtgagggtggccagagccatctctctgctgttcctggcactggtgcaagcccccttccgaatgccaggctgccttagggggcatcatggtcaggttcatgtattaacttggccaggtagtatctggtcatctggttgggcaagcgctgacctatttgttgctatgaggacatttcattgactta

//