LOCUS       XM_076871942            6217 bp    mRNA    linear   ROD 24-SEP-2025
DEFINITION  PREDICTED: Callospermophilus lateralis ATPase copper transporting
            beta (Atp7b), transcript variant X2, mRNA.
ACCESSION   XM_076871942
VERSION     XM_076871942.1
DBLINK      BioProject: PRJNA1331734
KEYWORDS    RefSeq.
SOURCE      Callospermophilus lateralis (golden-mantled ground squirrel)
  ORGANISM  Callospermophilus lateralis
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia;
            Sciuromorpha; Sciuridae; Xerinae; Marmotini; Callospermophilus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_135316) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_048772815.1-RS_2025_09
            Annotation Pipeline         :: NCBI Eukaryotic Genome Annotation
                                           Pipeline (EGAP)
            Annotation Software Version :: 10.5
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 09/22/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6217
                     /organism="Callospermophilus lateralis"
                     /mol_type="mRNA"
                     /isolate="mCalLat2"
                     /db_xref="taxon:76772"
                     /chromosome="12"
                     /sex="male"
                     /tissue_type="brown fat"
                     /dev_stage="adult"
                     /geo_loc_name="USA: Rustic, Colorado"
                     /lat_lon="40.6956 N 105.5943 W"
                     /collection_date="2018-05-09"
                     /collected_by="Gregory Florant"
     gene            1..6217
                     /gene="Atp7b"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 1 Protein, and 99% coverage of the annotated genomic
                     feature by RNAseq alignments, including 1 sample with
                     support for all annotated introns"
                     /db_xref="GeneID:143411276"
     CDS             72..4316
                     /gene="Atp7b"
                     /codon_start=1
                     /product="copper-transporting ATPase 2 isoform X2"
                     /protein_id="XP_076728057.1"
                     /db_xref="GeneID:143411276"
                     /translation="

MKQSFAFDNVGYEGGLDGMCPSQTATGTISIQGMTCQSCVKSIEGRISGLKGVVSIKVSLEQGSATVKYVPSVMSLQQICHQIEEMGFEASIAEGKASSWPSRSLPAQEAVVKLRVEGMTCQSCVNSIEGKIRKLQGVVRVKVSLSNQEAVITYQPYLIQPEDLRDHISDMGFEAAIKHKTAPLSLGPIDIGRLQSINPKRLSASANQNFNNSETSGHQGSHVVTLQLGVDGMHCNSCVLNIEKNIGQLPGVQGIQVSLENKTALVEYDPSSITPVSLKRAIEALPPGHYKVSLPAGAGGTGTDGETSDQHFPSSSQRNQGQAACSTVVLAITGMTCASCVQSIEGILSQREGVKRVSVSLAEGTGTFLYDPTVISPEELRAAIEDMGFEASVIPEKYSANHAGSHGAGNTMRQTLAGTSVSVPEVAPHGGVLPKKHSAGPLPNFPPPTGTVAPQKCFLQIKGMTCASCVSNIERNLQKEAGVLSVLVALMSGKAEVKYHPEVIQPPRIAQLIQDMGFEVSVMEDNAGADGDIELIVTGMTCASCVHNIESRLTRTNGITYASVALATSKAHVKFDPEIIGPRDIVKIIEELGYHASLSQRKPNAHHLDHKMEIKQWKKSFLCSLVFGIPVMGIMIYMLIPSKDSQEVMVLDHNIIPGLSILNLIFFILCTFVQFLGGWYFYVQAYKSLRHKSANMDVLIVLATSIAYAYSIVILVVAIAEKAEKSPVTFFDTPPMLFVFIALGRWLEHVAKSKTSEALAKLMSLQATEATVVTLGEDNLIIREEQVPMELVQRGDIIKVVPGGKFPVDGKVLEGNTMADESLITGEAMPVTKKPGSIVIAGSINAHGSVLIKATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADRFSGYFVPFIIIISTLTLVNPNKHISQTEVIIRFAFQTSITVLCIACPCSLGLATPTAVMVGTGVAAQHGILIKGGKPLEMAHKIKTVMFDKTGTITYGVPRVMRFLLLTDVATLPLRKVLAVVGTAEASSEHPLGVAVTKYCKEELGTETLGYCMDFQAVPGCGIGCKVSNVEGILAHSEHPQSQWAGHPKEVGSLPRGKDAAPQTFSVLIGNREWMRRNGLTISSDVSDAMTDHEMKGQTAILVAIDGVLCGMIAIADAVKPEAALAVHTLKSMGIDVVLITGDNRKTARAIATQVGINKVFAEVLPSHKVAKVQELQNEGKKVAMVGDGVNDSPALAQADVGIAIGSGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRVNLVLALIYNMVGIPIAAGVFMPVGIVLQPWMGSAAMAASSVSVVLSSLQLKCYRKPDLERYEAQAHGRMKPLSASQVSVHVGMDDRRRDSPRATPWDQVSYVSQVSLSSLTSDRLSRHSAAVDNGGDKWSLLLNDRDEEQYI"

     misc_feature    153..344
                     /gene="Atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(171..179,186..188)
                     /gene="Atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    408..599
                     /gene="Atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(426..434,441..443)
                     /gene="Atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    750..926
                     /gene="Atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(768..776,783..785)
                     /gene="Atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1050..1253
                     /gene="Atp7b"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1446..1634
                     /gene="Atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1461..1469,1476..1478)
                     /gene="Atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1671..1862
                     /gene="Atp7b"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1689..1697,1704..1706)
                     /gene="Atp7b"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1926..3980
                     /gene="Atp7b"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2865..2867,2871..2873,3909..3911)
                     /gene="Atp7b"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2997..3005,3207..3209,3360..3368,3456..3458,
                     3576..3584,3642..3644,3651..3653,3660..3662,3717..3719,
                     3726..3728)
                     /gene="Atp7b"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      

cagccagagaagaggctagtcggaaaatcttctctaaactttctgtgcctactcattcctgggtcccagccatgaagcagagttttgcctttgacaatgtcggctacgaaggtggtctggatggcatgtgcccttctcagacagccactggcacgatcagcatccagggtatgacttgccagtcgtgtgttaagtccatcgagggtcgaatatctggtttgaaaggcgtcgtgagcattaaggtttctctggaacaaggcagcgcaactgtgaaatacgtgccatcagtcatgagcctgcaacagatttgccatcaaattgaggaaatgggtttcgaggccagcattgcagaaggaaaagcttcctcatggccttcaaggtccttaccagcccaggaggcagtggtcaagctaagggtggagggcatgacctgccagtcctgtgtcaactccatcgaaggcaagatccggaaactgcagggagtggtgagagtcaaagtttcactcagcaaccaagaggcagtcatcacttaccagccttatcttattcaacctgaagacctcagggaccatataagtgatatgggatttgaagctgccatcaagcacaaaacagctcccttaagcctgggaccaattgatattggccgcttacagagcattaacccaaagagactgtcggcttctgctaatcagaatttcaataattctgagacctcagggcaccaaggaagccatgtggttaccctgcaactgggagtagatggaatgcactgtaactcttgtgtcttgaacattgaaaaaaatattggccaactcccaggggttcaaggtattcaagtgtccctggagaacaaaactgccctagtagagtatgacccttcttctatcacccctgtgtctttaaagagagccattgaggcccttccacctgggcactataaagtttctcttcctgctggagcaggagggactgggacagacggtgagacttctgaccagcatttccccagttcctcccagagaaaccaggggcaggctgcatgcagcactgtggtgcttgccatcaccggcatgacctgtgcgtcctgtgtccagtccatcgaaggcatactttcccagcgggaaggggtgaagcgagtatctgtctctttggctgaagggactgggacttttctttatgatcccactgtaattagcccggaagaactcagagctgctatagaagacatgggatttgaagcctcagtgattcctgaaaagtattctgccaaccatgctggaagccatggtgctgggaataccatgcggcaaactctggctggcacctctgtgtctgtgccggaagtggctccccatggtggagtgctccctaaaaaacacagcgctggccccttgccaaatttcccaccacccactggtacagtagcaccacagaagtgctttctgcagatcaaaggcatgacctgtgcatcctgtgtgtctaacatagaaaggaatcttcagaaagaagctggtgttctctcggtgttggttgccttgatgtcgggaaaagcagaggtcaagtatcatccggaggtcatccagccacccaggatagctcagctcatccaggacatgggctttgaggtgtcagtcatggaagacaacgcaggcgcggatggcgacattgagctgattgtcacagggatgacctgcgcttcctgtgttcacaacatagagtccaggctcaccaggacaaacggcatcacctatgcctcagtggcccttgccaccagcaaagcccatgtgaagtttgatcccgaaattatcggtccacgggatattgtcaaaattattgaggaactcggctatcatgcctccctgtcccagagaaagcccaacgctcatcacttggaccacaagatggaaataaagcagtggaagaagtctttcctgtgcagcctggtgtttggcatcccggtcatgggtataatgatctacatgttgatccccagcaaggactcccaagaagtgatggtcctggaccacaatatcattccagggctgtccatcctaaacctcatcttcttcatcttgtgtacctttgtccagttcctcggtgggtggtacttctacgtccaggcctacaaatctctgcgacacaagtcggccaacatggacgtgctcatcgtactggccacgagcatcgcctatgcctactccatcgtcatcctggtggtcgcaattgctgagaaggctgagaagagccctgtgaccttctttgacacgccccccatgctctttgtgttcattgccctagggcggtggctggaacacgtggcaaagagcaaaacctcagaagctcttgccaaactcatgtctctccaagccacagaagccacagtggtgaccctgggcgaggataacttaatcatcagagaggagcaagtgcccatggagctggtgcagcggggtgatatcatcaaggttgtccctgggggaaaattcccagtggatggaaaggtcctggaaggcaataccatggctgacgagtccctcatcacaggagaagccatgcctgtcactaagaaacctgggagcattgtgatcgccgggtctatcaatgcacatggctctgtgctcattaaagccacccatgtgggcaatgacaccactttagctcaaattgtaaaattggtggaagaggctcagatgtcaaaggctcccattcagcaactggctgaccgatttagtggatattttgtcccatttatcatcatcatttcaacattgacgttggtgaaccccaacaagcacatctcccagacagaggtgatcatccggtttgccttccagacgtccatcactgtgctgtgcattgcctgtccctgttccctgggattggccacgcccacggcggtcatggtggggaccggggtggccgcacagcacggcatcctcatcaagggaggcaagcctctggagatggcgcacaagatcaagaccgtgatgtttgacaaaactggtaccattacctatggggtccccagagtcatgcgattcctgctgctcacagatgtggctacacttccccttaggaaggttctggctgtggtggggactgcagaggccagcagcgagcaccccttgggtgtggcagtcaccaaatactgtaaagaggaacttggaacagagaccttgggatactgcatggacttccaggcggtgccaggctgtggaatcggctgcaaagtcagcaatgtggagggcatcctggcccacagtgagcacccccagagccagtgggccggacacccaaaggaagttggcagccttcctaggggaaaagatgcggctccccagaccttctcggtgctgatcggaaaccgcgaatggatgagacgcaatggcttaaccatctccagcgacgttagtgatgctatgacagatcatgagatgaagggacagaccgccatcctggtggccattgatggtgtgctctgtgggatgatcgccatcgctgatgctgtcaagccagaggctgccctggctgtgcacacactgaaaagcatgggtatagatgtggttctgatcacaggggacaaccggaagacagccagagccattgccacccaggttggtatcaacaaagtttttgcagaggtgctaccttctcacaaggtggccaaggtccaggagctgcagaacgaagggaagaaagttgccatggtgggagatggggtgaatgactcccccgccttggctcaggccgacgtgggcattgccattgggagtggcacggatgtggccatcgaggcagctgatgtcgtcctcatcagaaatgacttgctggatgtggtggccagcattcacctctccaagaggactgtccggcggatccgggtcaatctggtgctggcattgatttataacatggttgggatacccatcgcagcaggcgtcttcatgcccgttggcattgtgctgcaaccctggatgggctcggcggccatggcggcctcctcagtgtctgtggtgctctcttctctgcagctcaagtgctacaggaaacccgacctggagaggtacgaggctcaggcccatggccgcatgaagcctctgagcgcgtcccaggtcagcgtgcatgtcggcatggacgaccggagacgagactcccccagggccacaccgtgggaccaggtcagctatgtcagccaggtgtctctgtcctccctgacgtccgacaggctgtctcggcacagcgccgcagtggacaatggtggggacaagtggtctctgctcctgaatgacagggatgaggaacagtacatctgaaggctccaggtgagcagatccagggctggccagggcccagttcctcccaaggagattcacatctactctctgcagttcactggagcaggtacagtcccagcaggctgcagcagcttgagcaaaactcacctgcaccttgaggactcccattccctggatgttcccatcagccctccctgcagcctgcggcctggcccaggtgcagcccggattggactccctgcctggtcttcctggcgcaggcaaagcagcctggactcaccatgctggcattgtgggaaccttgctgggactccagagaggagagaagtcagtgttcctcgcacgcctctgctgggagtatttagggtgcctgcttgtgaaatgaggaacaaaatcatcaggaccagaaagctagctggacctctccagggaacgccaataaaactcgcagctggcctcttgatgatgtccaggtgcccgtgcgtctgagcccatggtttacctccaatgtgcctactgtttcctgctagcaccatctctcccttttctgccctcatgttgcttggcgtccttgacactggggatgtgcctgtccatcatctggggcaggactgacgcccacatccagccaatctgctagtccacaccccagcccaggagctggccatatccctcatcatgctcaggagagccgcttcttgctaagagccgcttctgcagagtcatgcatggtgctactgacctggagtccagttcagcttcctgtggggcccaggtgctaatgacccagggtgtcctgttgtccctgcctcaggttctggtgcttgaaacagaggccctgtgggaggcatatgtgtgcaggaacctccctgtcacttcacagggtctagtagagcattcaggtcactagtgtccctgtgttacgaggcacctgtcccccgatgaaaggagagcacagttttccaggagtcttctgcacacagagtgggcgctagagggagggtagcctcagctccccaggggaaagtctgcttttacctgtcagtggtactttgtgattgtgtgacatcagaggggcagggatgagcccagatgtaggctctgaagtcagtggtgattgacaggacacctgggagcagcctggcagaattagactatccaaggtgaaatcctggtctcatacaaaataatcttagttatttattgagtatcacttatttaccaggagcagtactggtacattttgtaggttatctctaaccccctcaacaacaaagtagcaatttagttattttttcacattttgcaggcaaagaaacaggttcagagaggctaaatattttgccgaggctcacacagccaatacatacacaatgtctttgactttgaaggcttctctaattctcctgccaccttaaatgtcagtttatttgataagaacaaagtagaaaaaggtccttgcccctggaaaagcaaatctgccaggttatgtattatttatatcaacttcgaatgcagttggtcacaaggtcatcccaccttcactttggatggttattttcaatttttgcatataatgtagtcttgttggattttatctcctaaaatccacttttgggttttgttgtgctctcactgtttgcagtctttctccccttctctgctaaccccttccatgatccctccccatcgtatcctccttttattcttgcttgggggatatttcttattttgaaactaggctaatcattttctaaagaatctaattgtattgaattttaaaactgctagaactgtaagcattgttcatatttagacatgaaaatatttatataattgtacagaaaataaccttttagatgttcaaagtgtcaggaacttttttggtcaggtaacagtgcctacttcaaaaactttac

//