ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-05-10 19:43:29, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_074913595 6147 bp mRNA linear VRT 01-JUL-2025
DEFINITION PREDICTED: Athene noctua ATPase copper transporting beta (ATP7B),
mRNA.
ACCESSION XM_074913595
VERSION XM_074913595.1
DBLINK BioProject: PRJNA1281187
KEYWORDS RefSeq.
SOURCE Athene noctua
ORGANISM Athene noctua
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Strigiformes;
Strigidae; Athene.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_134037) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Full annotation
Annotation Name :: GCF_965140245.1-RS_2025_06
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.4
Annotation Method :: Gnomon; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 06/27/2025
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..6147
/organism="Athene noctua"
/mol_type="mRNA"
/db_xref="taxon:126797"
/chromosome="1"
/geo_loc_name="United Kingdom:Stretham|Ely|Broad Baulk"
/collection_date="2021-07-09"
gene 1..6147
/gene="ATP7B"
/note="ATPase copper transporting beta; Derived by
automated computational analysis using gene prediction
method: Gnomon. Supporting evidence includes similarity
to: 11 Proteins, and 96% coverage of the annotated genomic
feature by RNAseq alignments"
/db_xref="GeneID:141963879"
CDS 30..4325
/gene="ATP7B"
/codon_start=1
/product="copper-transporting ATPase 2"
/protein_id="XP_074769696.1"
/db_xref="GeneID:141963879"
/translation="
MKHHFAFDNMGYEESFETVPSPSSQEQTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQTEINPEQICQEIQDMGFDANIAEERLTTATVNSSCLREAVVKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKSAPLKLGVLDLERLQNANPKEIPASLESDRVDPLVAEMSSTATMALRIEGMHCKSCVRNIEGNISDLPGIQSIKVSLEHKCAVVQYSPNLITLSALKQAIESLPPGNFKVCFLNGSEANKGASPSPALLYDLFREPLQDMTCTAVVKIDGMTCNSCVQSIEGAISQRQGVQRIAVSLAGRTGTIHYDPAITNGEELRAAIEEMGFDASVLTDTAAGECRHQPDTSNAAVQPQPPESSHQDCASDALPDSPHLDGPKEHSRLTAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPDFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVAKRVPNAHNLDHKKEIQQWRKSFMCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYVYSCVILMVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIVREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGSQSLGYCTDFQAVPGCGISCKVGGVEAVLDMTEEGIDNLDTNRSRDSSAPLGDNALIMLSKSHGSSASHTYSVLIGNREWMQRNGLHIANDVNDAMTDHETKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRSAPWDQISQVSLSSLTSDKLPRRNGFVEEEGDKWSLLMNGGDEEQYI"
misc_feature 120..305
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(135..143,150..152)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 372..563
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(390..398,405..407)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 711..884
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(726..734,741..743)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1002..1208
/gene="ATP7B"
/note="Copper chaperone CopZ [Inorganic ion transport and
metabolism]; Region: CopZ; COG2608"
/db_xref="CDD:442020"
misc_feature 1377..1565
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1392..1400,1407..1409)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1602..1793
/gene="ATP7B"
/note="Heavy-metal-associated domain (HMA) is a conserved
domain of approximately 30 amino acid residues found in a
number of proteins that transport or detoxify heavy
metals, for example, the CPx-type heavy metal ATPases and
copper chaperones. HMA domain...; Region: HMA; cd00371"
/db_xref="CDD:238219"
misc_feature order(1620..1628,1635..1637)
/gene="ATP7B"
/note="metal-binding site [ion binding]"
/db_xref="CDD:238219"
misc_feature 1872..3998
/gene="ATP7B"
/note="P-type heavy metal-transporting ATPase, similar to
human copper-transporting ATPases, ATP7A and ATP7B;
Region: P-type_ATPase_Cu-like; cd02094"
/db_xref="CDD:319783"
misc_feature order(2850..2852,2856..2858,3927..3929)
/gene="ATP7B"
/note="putative Cu binding site [ion binding]; other site"
/db_xref="CDD:319783"
misc_feature order(2982..2990,3192..3194,3378..3386,3474..3476,
3594..3602,3660..3662,3669..3671,3678..3680,3735..3737,
3744..3746)
/gene="ATP7B"
/note="putative ATP binding site [chemical binding]; other
site"
/db_xref="CDD:319783"
ORIGIN
ctcctcctggctgtgagctggagcctacaatgaaacaccattttgcttttgacaacatgggctatgaggagagctttgaaactgtgccctctccatcttcccaagaacaaaccgtggcagtcaatattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtcaagggcattgtgagtattaaagtctcccttgaacagaacaatgctgtaataaagtatctgcagacagaaataaatcctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagagattgacaacagcaactgtaaattcgtcatgcttgagagaagcagtagttaagcttcgggtagaaggcatgacgtgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagccatatcagtaacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgtcctcgatctggagcgcttgcagaatgcaaaccccaaggagataccagcaagtcttgagagtgatcgagtggatcccctggtcgctgagatgagtagcacagctacaatggctctacggatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatcagatcttcctggcatacaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtatagcccaaatctaattaccctgtcagctttgaagcaagctattgaatcccttccacctggaaactttaaagtatgcttccttaatggttcagaagcaaataaaggagcatctccatcacccgctttgctatatgatctcttcagagagccactgcaagacatgacatgcacagctgttgttaagatcgatggcatgacctgcaattcttgtgtacagtctatagaaggggctatatcacagagacaaggagtgcaacgtatagcagtttctctagccggcagaactgggaccatacattatgatccagctattactaatggagaagagttaagagctgccatagaagagatggggtttgatgcttctgtgctgacagataccgccgctggagaatgtaggcaccagcctgataccagcaacgctgctgtgcagcctcaacctccagagtcttctcaccaagactgtgcctcggatgctcttccagacagtcctcaccttgatggaccaaaagagcacagcagactgacagctgaaaagtgttttttacaaatcacgggcatgacctgtgcatcatgtgtatctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttagtagcactgatggcaggtaaagcagagataaaatacaagccagattttatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccgtcatagaagatcatgcagaaacagaagggaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatctaaactcatgagaacaaatggcatattttatgcctcagttgcacttgctacttgcaaagctcacatccaatttgatcctgaaatcactggacctcgagatattataaaaataattgaggaaattggctttcatgcttccgtggctaaaagagttccaaatgcacataacctggatcataaaaaggaaatacagcagtggaggaaatctttcatgtgcagcctcttgtttgggatccctgtcttaatcctaatgatttatatgctaatacctgacggtgagcaccacgggtctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttcttcgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtacaagcttacaaatcactgaagcacaagacagccaatatggatgtgctcatcgtactggccacgacgattgcttatgtatattcatgtgtgatcctgatggtagcaataattgaaaaggcagagaaaagccctgtcactttctttgacacccctccaatgctgtttgtgttcattgcccttggaagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccactgtagtgactcttggacctgaccactctatcgtcagggaggagcaggtagctgttgaactggttcaaaggggtgatattgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaattgtgaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaattttgatgttattcaaaaatattttcctaatcagaacaaacatgtttcaaaagctgaattaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcctggctacccccacagctgtgatggtgggcacaggagttgctgcgcagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactgggaccatcacctgtggagttcctaaagtcatgagggtgcttttgctaggagacacagctgtgctctctctgaagaaggtactggcagtggttggcactgcagaagccagcagtgagcatcctttaggagtggcagtcactaaatattgcaaagaggagcttggctctcagagcctgggatactgcactgatttccaggcagtcccaggctgtggcatcagctgcaaagtcggaggtgtggaggctgtcctggacatgactgaggagggtattgataatctggacactaacaggagcagagacagcagtgctcctctgggagataatgcattgatcatgctctccaaatcacatggttcatcagcttctcatacatactcagtgctgattggaaatcgtgagtggatgcaacgcaatggcttgcatattgcaaatgatgtaaatgatgcaatgacagaccatgaaacaaaaggacagactgccatactagtggctatagatggtgtgttgtgtggaatgatcgcaatagcagacactgtcaagcaggaggctgcccttgctgtgcacacactgaaaaacatgggaatagatgtggtgctgataacaggggacaacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaggttgcaaaagtccaggagctccaaaatgggaggaagaaggttgcaatggttggtgatggagtcaatgattcccctgcactagccagggccgacgttggaattgcaattggaactggtacagatgttgctattgaagcagcagatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctcattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggcctcgtgcttcagccttggatgggatcagcagcaatggcagcttcttctgtctctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagatacagaaagttatgaagcacaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagatcggctccttgggatcagattagtcaagtttctctctcttccttgacttcagacaagttgccaagacgtaatggttttgttgaggaggaaggggacaagtggtctttgctcatgaatggaggggatgaagaacagtacatctgaagcactgtattcttactactggaggaaatgttcctctttactagtgacaggagggaccaacttatttcatcaggagcttcaagactgtaagtgaagtcattccttcagctcacaaaacaattgcaactcagctcaatattgggttgtatggattgtggattttttttcaggtcaccagttatttctagtcatggaaagaatctgtggctctttaatgaactgtgcagtttgcacacagcaattagtgaaataatgtaaaatttgtcattttcagagtctaaaagagtttctcttatctggacggcttgctgggcaccaaattctatacttttgctcattctaactttattctttcaagagtacatgaagcaaaagtattttcagagctgccaaatattaatttctctgtccaagtgaaaatatctatggcgtaaggatctctgtggccagaagttgtatctttacacaaaatcctgactagtcacataactgtgagagcactttgtatttgggattcatgtgcatctccttggaccaaaaatgctttggtgtttcactgactataactctgtgaaaagtctctttcaaagattttcacttgctttccggtattgcatccttttgatgcacatttccattgctaaacttgttctgtcattcccactgctctcctagattttctcttttgctccatgagagctctttttttccccctttgcacaagatatcttctgtgagtcattactatgtttacagatattcctgtttgggacaaactcctttaagtcaccagaacttttctgttcctattgaagtccacaaaggcagagcaattcctggtccaagtcagcatataattttcctgtggatactttgcaggaccccatgaagctcctgacaattgggaagttgtctgtctcttccctctgacacagtgaagaatttatgccagtgtgagcaaatgtggtatttaccatgatgcaaatgagagcagaactagcactggtgtgactccagcatggctgaaaggagtgagtttattgcataagttaactctagcttgctagttgcttaaaatggagccaaaagtttaaatgataaaggtggaaaaatgtccttaaaatgtggggcttccatttgctaccatataaataaccttttctgatgacagaaggactcaaactaagaagatttgtaatatcttgaattttaatgtaaatttgtgttcatgctctgaattagttttaatttccctatttctctagtttccttagaaatcaaggtgctgaacaacccttttttcactttaatgtctttaccaaagcttgcagtaactttatcagtgtgaaagtcaaattaatcccttaacactttttagtcaggacagtaggaatcaacagctttggagcactgaatctggtcccgtggtgctgtgttgctcaattgtgggactttgaagcaggcagactggagttttatagcctaatctaaaaagtgaaagaacaggaattactgtgctaagcaatgtgaaataaccgcttaatttcactgacttaaagacagaactatttctaacacaggttcaaatcctgctcctcctaatgtaaaaatgaaaaacaagtgagagaggaaaagaattgtgcttgaagcattgagcaggtcttcctattccctcttcctctacagttttaaaactgtaaaatctttttacatttgtagagatcacttccacagcacacacacttttcaaacatcctgtagcttcctatacatgtccctgtggggaagatagtctattgtttcacgcttttatgttttctta
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]