GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-05-10 19:43:29, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_074913595            6147 bp    mRNA    linear   VRT 01-JUL-2025
DEFINITION  PREDICTED: Athene noctua ATPase copper transporting beta (ATP7B),
            mRNA.
ACCESSION   XM_074913595
VERSION     XM_074913595.1
DBLINK      BioProject: PRJNA1281187
KEYWORDS    RefSeq.
SOURCE      Athene noctua
  ORGANISM  Athene noctua
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
            Coelurosauria; Aves; Neognathae; Neoaves; Telluraves; Strigiformes;
            Strigidae; Athene.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_134037) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_965140245.1-RS_2025_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.4
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/27/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..6147
                     /organism="Athene noctua"
                     /mol_type="mRNA"
                     /db_xref="taxon:126797"
                     /chromosome="1"
                     /geo_loc_name="United Kingdom:Stretham|Ely|Broad Baulk"
                     /collection_date="2021-07-09"
     gene            1..6147
                     /gene="ATP7B"
                     /note="ATPase copper transporting beta; Derived by
                     automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 11 Proteins, and 96% coverage of the annotated genomic
                     feature by RNAseq alignments"
                     /db_xref="GeneID:141963879"
     CDS             30..4325
                     /gene="ATP7B"
                     /codon_start=1
                     /product="copper-transporting ATPase 2"
                     /protein_id="XP_074769696.1"
                     /db_xref="GeneID:141963879"
                     /translation="
MKHHFAFDNMGYEESFETVPSPSSQEQTVAVNIVGMTCQSCVQSIEGRISKVKGIVSIKVSLEQNNAVIKYLQTEINPEQICQEIQDMGFDANIAEERLTTATVNSSCLREAVVKLRVEGMTCQSCVTNIEGKIRKLHGVAKIKVSLGNQEAIIAYYPYIIQPDDLKSHISNLGYDCTIKSKSAPLKLGVLDLERLQNANPKEIPASLESDRVDPLVAEMSSTATMALRIEGMHCKSCVRNIEGNISDLPGIQSIKVSLEHKCAVVQYSPNLITLSALKQAIESLPPGNFKVCFLNGSEANKGASPSPALLYDLFREPLQDMTCTAVVKIDGMTCNSCVQSIEGAISQRQGVQRIAVSLAGRTGTIHYDPAITNGEELRAAIEEMGFDASVLTDTAAGECRHQPDTSNAAVQPQPPESSHQDCASDALPDSPHLDGPKEHSRLTAEKCFLQITGMTCASCVSTIERNLQKEDGIVSVLVALMAGKAEIKYKPDFIQPLEIAQLIQNLGFEATVIEDHAETEGNVELLITGMTCASCVHNIESKLMRTNGIFYASVALATCKAHIQFDPEITGPRDIIKIIEEIGFHASVAKRVPNAHNLDHKKEIQQWRKSFMCSLLFGIPVLILMIYMLIPDGEHHGSMVLEQNLIPGLSILNLLFFVLCTFVQFLGGWYFYVQAYKSLKHKTANMDVLIVLATTIAYVYSCVILMVAIIEKAEKSPVTFFDTPPMLFVFIALGRWLEHIAKSKTSEALAKLISLQATEATVVTLGPDHSIVREEQVAVELVQRGDIVKVVPGGKFPVDGKVIEGSSMADESLITGEAMPVTKKPGSTVIAGSINAHGSVLVNATHVGNDTTLAQIVKLVEEAQMSKAPIQQLADKFSGYFVPFIIIISTVTLIVWITIGFINFDVIQKYFPNQNKHVSKAELILRFAFQTSITVLSIACPCSLGLATPTAVMVGTGVAAQNGILIKGGKPLEMAHKIKTVMFDKTGTITCGVPKVMRVLLLGDTAVLSLKKVLAVVGTAEASSEHPLGVAVTKYCKEELGSQSLGYCTDFQAVPGCGISCKVGGVEAVLDMTEEGIDNLDTNRSRDSSAPLGDNALIMLSKSHGSSASHTYSVLIGNREWMQRNGLHIANDVNDAMTDHETKGQTAILVAIDGVLCGMIAIADTVKQEAALAVHTLKNMGIDVVLITGDNRKTAKAIATQVGIKKVFAEVLPSHKVAKVQELQNGRKKVAMVGDGVNDSPALARADVGIAIGTGTDVAIEAADVVLIRNDLLDVVASIHLSKRTVRRIRINLILALIYNLLGIPIAAGVFMPVGLVLQPWMGSAAMAASSVSVVLSSLQLKCYKKPDTESYEAQAQGRMKPLTPSQISVHIGMDDRRRDSSRSAPWDQISQVSLSSLTSDKLPRRNGFVEEEGDKWSLLMNGGDEEQYI"
     misc_feature    120..305
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(135..143,150..152)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    372..563
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(390..398,405..407)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    711..884
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(726..734,741..743)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1002..1208
                     /gene="ATP7B"
                     /note="Copper chaperone CopZ [Inorganic ion transport and
                     metabolism]; Region: CopZ; COG2608"
                     /db_xref="CDD:442020"
     misc_feature    1377..1565
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1392..1400,1407..1409)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1602..1793
                     /gene="ATP7B"
                     /note="Heavy-metal-associated domain (HMA) is a conserved
                     domain of approximately 30 amino acid residues found in a
                     number of proteins that transport or detoxify heavy
                     metals, for example, the CPx-type heavy metal ATPases and
                     copper chaperones. HMA domain...; Region: HMA; cd00371"
                     /db_xref="CDD:238219"
     misc_feature    order(1620..1628,1635..1637)
                     /gene="ATP7B"
                     /note="metal-binding site [ion binding]"
                     /db_xref="CDD:238219"
     misc_feature    1872..3998
                     /gene="ATP7B"
                     /note="P-type heavy metal-transporting ATPase, similar to
                     human copper-transporting ATPases, ATP7A and ATP7B;
                     Region: P-type_ATPase_Cu-like; cd02094"
                     /db_xref="CDD:319783"
     misc_feature    order(2850..2852,2856..2858,3927..3929)
                     /gene="ATP7B"
                     /note="putative Cu binding site [ion binding]; other site"
                     /db_xref="CDD:319783"
     misc_feature    order(2982..2990,3192..3194,3378..3386,3474..3476,
                     3594..3602,3660..3662,3669..3671,3678..3680,3735..3737,
                     3744..3746)
                     /gene="ATP7B"
                     /note="putative ATP binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:319783"
ORIGIN      
ctcctcctggctgtgagctggagcctacaatgaaacaccattttgcttttgacaacatgggctatgaggagagctttgaaactgtgccctctccatcttcccaagaacaaaccgtggcagtcaatattgtgggaatgacttgccaatcatgtgtgcagtcgatagaaggccgaatttccaaggtcaagggcattgtgagtattaaagtctcccttgaacagaacaatgctgtaataaagtatctgcagacagaaataaatcctgaacagatttgccaggaaattcaggatatgggctttgatgccaacatagcagaagagagattgacaacagcaactgtaaattcgtcatgcttgagagaagcagtagttaagcttcgggtagaaggcatgacgtgccagtcctgtgtcaccaacattgaaggaaagattaggaaactgcatggtgtggcaaaaatcaaggtgtcacttggtaaccaggaagcaattattgcttactatccttacatcattcagcctgatgacctcaagagccatatcagtaacctggggtatgactgcaccattaaaagtaaatcagcccctttgaagctgggtgtcctcgatctggagcgcttgcagaatgcaaaccccaaggagataccagcaagtcttgagagtgatcgagtggatcccctggtcgctgagatgagtagcacagctacaatggctctacggatagaaggcatgcactgcaagtcctgtgtcagaaacattgaaggaaatatatcagatcttcctggcatacaaagtattaaagtgtctttggagcataaatgtgctgtggtacagtatagcccaaatctaattaccctgtcagctttgaagcaagctattgaatcccttccacctggaaactttaaagtatgcttccttaatggttcagaagcaaataaaggagcatctccatcacccgctttgctatatgatctcttcagagagccactgcaagacatgacatgcacagctgttgttaagatcgatggcatgacctgcaattcttgtgtacagtctatagaaggggctatatcacagagacaaggagtgcaacgtatagcagtttctctagccggcagaactgggaccatacattatgatccagctattactaatggagaagagttaagagctgccatagaagagatggggtttgatgcttctgtgctgacagataccgccgctggagaatgtaggcaccagcctgataccagcaacgctgctgtgcagcctcaacctccagagtcttctcaccaagactgtgcctcggatgctcttccagacagtcctcaccttgatggaccaaaagagcacagcagactgacagctgaaaagtgttttttacaaatcacgggcatgacctgtgcatcatgtgtatctaccattgaaagaaatttgcagaaagaagatggaattgtttcagtgttagtagcactgatggcaggtaaagcagagataaaatacaagccagattttatacagcctcttgaaatagcacagctgatccagaatttgggttttgaagctaccgtcatagaagatcatgcagaaacagaagggaatgtggagcttcttattacagggatgacttgtgcttcttgtgttcacaatattgaatctaaactcatgagaacaaatggcatattttatgcctcagttgcacttgctacttgcaaagctcacatccaatttgatcctgaaatcactggacctcgagatattataaaaataattgaggaaattggctttcatgcttccgtggctaaaagagttccaaatgcacataacctggatcataaaaaggaaatacagcagtggaggaaatctttcatgtgcagcctcttgtttgggatccctgtcttaatcctaatgatttatatgctaatacctgacggtgagcaccacgggtctatggtgctggaacagaatctcattcctggattatctattttaaatcttctcttcttcgtcctgtgcacttttgttcagtttcttggtggatggtatttttatgtacaagcttacaaatcactgaagcacaagacagccaatatggatgtgctcatcgtactggccacgacgattgcttatgtatattcatgtgtgatcctgatggtagcaataattgaaaaggcagagaaaagccctgtcactttctttgacacccctccaatgctgtttgtgttcattgcccttggaagatggctggaacacatagcaaagagtaagacctcagaagctcttgctaaacttatatctcttcaagccacagaagccactgtagtgactcttggacctgaccactctatcgtcagggaggagcaggtagctgttgaactggttcaaaggggtgatattgtaaaggttgttcctggtggaaagttcccagtggatggaaaggtcattgaaggcagttctatggcagatgagtctctcattactggggaagctatgccagtcactaaaaagcctgggagcacagtgattgctggttctataaatgcacatggctcagttcttgttaatgcaactcatgttggtaatgataccactctggcacaaattgtgaaattggtggaagaagctcaaatgtcaaaggcacctatccagcaactggcagataagtttagtggatattttgttccatttatcatcatcatttcaacagtgacattgatagtatggatcacaattggttttataaattttgatgttattcaaaaatattttcctaatcagaacaaacatgtttcaaaagctgaattaatactgaggtttgcatttcaaacctcaatcactgtgctgagcattgcatgcccctgttctttaggcctggctacccccacagctgtgatggtgggcacaggagttgctgcgcagaatggtattctcatcaaaggtggaaaacccctggaaatggcacacaagatcaagactgtgatgtttgataaaactgggaccatcacctgtggagttcctaaagtcatgagggtgcttttgctaggagacacagctgtgctctctctgaagaaggtactggcagtggttggcactgcagaagccagcagtgagcatcctttaggagtggcagtcactaaatattgcaaagaggagcttggctctcagagcctgggatactgcactgatttccaggcagtcccaggctgtggcatcagctgcaaagtcggaggtgtggaggctgtcctggacatgactgaggagggtattgataatctggacactaacaggagcagagacagcagtgctcctctgggagataatgcattgatcatgctctccaaatcacatggttcatcagcttctcatacatactcagtgctgattggaaatcgtgagtggatgcaacgcaatggcttgcatattgcaaatgatgtaaatgatgcaatgacagaccatgaaacaaaaggacagactgccatactagtggctatagatggtgtgttgtgtggaatgatcgcaatagcagacactgtcaagcaggaggctgcccttgctgtgcacacactgaaaaacatgggaatagatgtggtgctgataacaggggacaacagaaaaactgcaaaagccattgctactcaggttgggatcaaaaaagtctttgctgaggttcttccttctcacaaggttgcaaaagtccaggagctccaaaatgggaggaagaaggttgcaatggttggtgatggagtcaatgattcccctgcactagccagggccgacgttggaattgcaattggaactggtacagatgttgctattgaagcagcagatgttgttcttatccgaaatgacttgctggatgtagttgccagtattcacttatcaaagagaacagttcgaagaatacgaataaatctcattcttgccttaatttataatctgcttggaatacccatagcagcaggtgtgttcatgcctgttggcctcgtgcttcagccttggatgggatcagcagcaatggcagcttcttctgtctctgtcgtgctgtcttccctgcagctgaaatgttataagaagccagatacagaaagttatgaagcacaagctcaaggccgcatgaagccacttactccttcccaaatcagtgttcatattggaatggatgataggaggagggattcatccagatcggctccttgggatcagattagtcaagtttctctctcttccttgacttcagacaagttgccaagacgtaatggttttgttgaggaggaaggggacaagtggtctttgctcatgaatggaggggatgaagaacagtacatctgaagcactgtattcttactactggaggaaatgttcctctttactagtgacaggagggaccaacttatttcatcaggagcttcaagactgtaagtgaagtcattccttcagctcacaaaacaattgcaactcagctcaatattgggttgtatggattgtggattttttttcaggtcaccagttatttctagtcatggaaagaatctgtggctctttaatgaactgtgcagtttgcacacagcaattagtgaaataatgtaaaatttgtcattttcagagtctaaaagagtttctcttatctggacggcttgctgggcaccaaattctatacttttgctcattctaactttattctttcaagagtacatgaagcaaaagtattttcagagctgccaaatattaatttctctgtccaagtgaaaatatctatggcgtaaggatctctgtggccagaagttgtatctttacacaaaatcctgactagtcacataactgtgagagcactttgtatttgggattcatgtgcatctccttggaccaaaaatgctttggtgtttcactgactataactctgtgaaaagtctctttcaaagattttcacttgctttccggtattgcatccttttgatgcacatttccattgctaaacttgttctgtcattcccactgctctcctagattttctcttttgctccatgagagctctttttttccccctttgcacaagatatcttctgtgagtcattactatgtttacagatattcctgtttgggacaaactcctttaagtcaccagaacttttctgttcctattgaagtccacaaaggcagagcaattcctggtccaagtcagcatataattttcctgtggatactttgcaggaccccatgaagctcctgacaattgggaagttgtctgtctcttccctctgacacagtgaagaatttatgccagtgtgagcaaatgtggtatttaccatgatgcaaatgagagcagaactagcactggtgtgactccagcatggctgaaaggagtgagtttattgcataagttaactctagcttgctagttgcttaaaatggagccaaaagtttaaatgataaaggtggaaaaatgtccttaaaatgtggggcttccatttgctaccatataaataaccttttctgatgacagaaggactcaaactaagaagatttgtaatatcttgaattttaatgtaaatttgtgttcatgctctgaattagttttaatttccctatttctctagtttccttagaaatcaaggtgctgaacaacccttttttcactttaatgtctttaccaaagcttgcagtaactttatcagtgtgaaagtcaaattaatcccttaacactttttagtcaggacagtaggaatcaacagctttggagcactgaatctggtcccgtggtgctgtgttgctcaattgtgggactttgaagcaggcagactggagttttatagcctaatctaaaaagtgaaagaacaggaattactgtgctaagcaatgtgaaataaccgcttaatttcactgacttaaagacagaactatttctaacacaggttcaaatcctgctcctcctaatgtaaaaatgaaaaacaagtgagagaggaaaagaattgtgcttgaagcattgagcaggtcttcctattccctcttcctctacagttttaaaactgtaaaatctttttacatttgtagagatcacttccacagcacacacacttttcaaacatcctgtagcttcctatacatgtccctgtggggaagatagtctattgtttcacgcttttatgttttctta
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]