ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-16 22:05:18, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_073349553 2763 bp mRNA linear VRT 19-APR-2025 DEFINITION PREDICTED: Lepidochelys kempii dicer 1, ribonuclease III (DICER1), transcript variant X16, mRNA. ACCESSION XM_073349553 VERSION XM_073349553.1 DBLINK BioProject: PRJNA1251686 KEYWORDS RefSeq. SOURCE Lepidochelys kempii (Atlantic ridley) ORGANISM Lepidochelys kempii Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira; Americhelydia; Chelonioidea; Cheloniidae; Lepidochelys. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_133261) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_965140265.1-RS_2025_04 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 04/18/2025 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2763 /organism="Lepidochelys kempii" /mol_type="mRNA" /isolate="rLepKem1" /db_xref="taxon:8472" /chromosome="6" /geo_loc_name="USA: Quincy, Massachusetts" /collection_date="2018-12-12" gene 1..2763 /gene="DICER1" /note="dicer 1, ribonuclease III; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:140913338" CDS 412..2679 /gene="DICER1" /codon_start=1 /product="endoribonuclease Dicer isoform X4" /protein_id="XP_073205654.1" /db_xref="GeneID:140913338" /translation="
MKSPALQSLSMAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNTGSGKTFIAVLLAKELSYQIRGDFNKNGKRTVFLVNSANQVAQQVSAVRTHSDLKVGEYSVLEIIESWTKEKWNQEFAKHEVLVMTCHVILNVLKNEYLSLSNINLLVFDECHLAIQDHPYQEIMKICENCPSCPRILGLTASILNGKCDPAELEEKIQKLEKILKSNAETATDLVVLDRYTSQPCEIVVDCGPYTDKSGLYERLLKELDEALNFLNDCNISVHSKERDSTLISKQILSDCRAVLVVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTFLRKIHALCEEHFSPASLDLKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDEDEEIEEKEKPETNFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEVEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPTEYRSYVQSKGRARAPISNYIMLADTDKIKSFEEDLKTYKAIEKILRNKCSKSVDTSETETESIVDDDDIFPPYVLRPDDSSPRVTINTAIGHINRYCARLPSDPFTHLAPKCKTRELPDTTFYSTLYLPINSPLRASIVGPPMSCARLAERVVALICCEKLHKIGELDDHLMPVGKETVKYEEELDLHDEEETNVPGRPGSTKRRQCYPKAEWC"
misc_feature 535..1128
/gene="DICER1"
/note="DEXH-box helicase domain of endoribonuclease Dicer;
Region: DEXHc_dicer; cd18034"
/db_xref="CDD:350792"
misc_feature order(535..546,553..555,604..627,748..750,937..939,
1030..1032)
/gene="DICER1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:350792"
misc_feature order(712..717,784..789,862..864,868..873,880..882,
955..963)
/gene="DICER1"
/note="nucleic acid binding site [nucleotide binding];
other site"
/db_xref="CDD:350792"
misc_feature 1228..1506
/gene="DICER1"
/note="Partner-binding domain of the endoribonuclease
Dicer; Region: Dicer_PBD; cd15903"
/db_xref="CDD:277191"
misc_feature order(1237..1242,1249..1251,1255..1260,1435..1440,
1447..1452,1459..1461,1468..1473,1480..1482)
/gene="DICER1"
/note="Trbp binding interface [polypeptide binding]; other
site"
/db_xref="CDD:277191"
misc_feature 1525..2103
/gene="DICER1"
/note="C-terminal helicase domain of the endoribonuclease
Dicer; Region: SF2_C_dicer; cd18802"
/db_xref="CDD:350189"
misc_feature order(1756..1764,1972..1974,2029..2031,2035..2037)
/gene="DICER1"
/note="DNA binding site [nucleotide binding]"
/db_xref="CDD:350189"
misc_feature order(1984..1986,1990..1992,2065..2067,2071..2073)
/gene="DICER1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:350189"
misc_feature 2299..2565
/gene="DICER1"
/note="Dicer dimerization domain; Region: Dicer_dimer;
pfam03368"
/db_xref="CDD:460900"
ORIGIN
aggaacctgacagctggggggagtgaggcggcggcggcggggaaatggcggcgggagcagcacaatgagacgcggcctgtagtctggaagctctgggctgggtccagtccggcaggttacctagggtgaaacaaaattacaggcttggaaactctggaaaagctctgtagcagcattagagagcagaagcttgcaaatgatgcaattaatgtacaaactgatatcatgatgtcaaaatgcagttcaaagaacacaaacacagatctcagaaattaaaacgcaggtcaggaagaatccgtcaggaactccagctgttgacaatactacatgggttatagaggaagctcttcagaggcagtaagctgtgctggaacaaaaatgcaatgaaagaaacactggatgaatgaatgaatgaaaagccctgctttgcaatccctcagcatggcaggactgcagcttatgacccctgcttcctcaccaatgggtcctttttttggactgccatggcaacaagaagcaattcatgataacatttacacgccaagaaaatatcaggttgaactgcttgaagcagctttggatcataatacgatagtctgtttaaacactggctcagggaagacttttattgcagtactacttgctaaagagctgtcctatcagatcaggggagacttcaacaaaaatggaaagagaacagttttcttggtcaactcagcaaatcaagttgctcagcaagtgtcagctgtcaggacccattcagatctgaaggtgggggagtattcagttttagaaataattgaatcatggacaaaggagaagtggaatcaagaatttgctaaacatgaggttctggttatgacatgtcatgtcattttgaatgttttaaaaaatgaatacttatccctgtcaaacattaatcttctggtgtttgatgagtgccatcttgcaatccaggaccatccgtatcaagaaattatgaagatctgtgagaactgtccatcctgtcctcgaatcctgggattaacagcttccattttaaatgggaaatgtgatcctgctgagttagaggagaagattcagaaactggagaaaatcctaaagagcaatgctgaaactgcaactgatttggtggtcttagatagatatacttctcagccatgtgagattgtggtagattgtggaccatataccgacaaaagcgggctgtatgaaagattgttaaaagaattggatgaagcacttaactttttaaatgactgcaacatatctgtacattcaaaagaaagagactctacgttaatttctaaacagatactgtcagactgtcgagctgtgttggttgttctgggaccctggtgtgcagataaggtagctggaatgatggtgagagagctacagaagtacatcaaacatgagcaagaggagctgcacaggaaatttttattgtttacagacactttcctaaggaaaatacatgcactgtgtgaagagcacttctcacctgcctcacttgatctgaaatttgtaaccccgaaagtaataaaactgcttgaaatcttgcgcaaatataaaccatatgagcggcagcagtttgaaagtgttgagtggtataataataggaatcaggataattatgtgtcttggagtgattctgaagatgatgatgaggatgaagaaattgaggagaaagaaaagccagagacaaatttcccttctccctttactaatattttatgtggaattatttttgtggaaaggagatacacagcagtcgtcctaaacaggttgataaaggaagctggaaaacaggatccagaactggcttacatcagtagcaattttataactggacatggcattggaaagaatcagcctcgtaacaaacagatggaagtggaattcagaaaacaagaagaggtacttagaaaatttcgagcacatgagaccaacttacttattgctactagtattgttgaagagggtgttgacataccaaaatgcaatttggtggttcgttttgatttgcccacagaataccgttcctatgtgcagtccaaaggaagagccagggcaccaatctcaaattacatcatgttagcagacacagacaaaatcaaaagttttgaagaagatcttaaaacctacaaagcaattgagaagatcctcagaaacaaatgctcaaagtccgttgatactagtgaaactgaaactgaatccatcgtggatgatgatgatatctttccaccctatgtgttgaggccagatgatagcagtccaagagttacaattaacactgcgattggacacatcaataggtactgcgcaagattaccaagcgatccatttactcatctggctcctaagtgtaaaacccgagaactgcctgatactacattttattcaactctctacctgccaatcaactcacctcttcgagcctctattgttggtcctccaatgagttgtgcaagactggctgagagagtggtagctcttatttgctgtgaaaagcttcacaaaattggtgaactggatgaccacttgatgccggttgggaaagaaacggttaagtatgaggaggagcttgatttacatgatgaagaagaaaccaatgttccaggaagaccaggatctacaaaacgaaggcagtgctaccctaaagctgaatggtgttaactacccctttgcctgacgagctcaactttaggaggcgaaagctgtatcctcctgaggatacaacaagatgctttggaatactga
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]