GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-16 22:05:18, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_073349553            2763 bp    mRNA    linear   VRT 19-APR-2025
DEFINITION  PREDICTED: Lepidochelys kempii dicer 1, ribonuclease III (DICER1),
            transcript variant X16, mRNA.
ACCESSION   XM_073349553
VERSION     XM_073349553.1
DBLINK      BioProject: PRJNA1251686
KEYWORDS    RefSeq.
SOURCE      Lepidochelys kempii (Atlantic ridley)
  ORGANISM  Lepidochelys kempii
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Archelosauria; Testudinata; Testudines; Cryptodira; Durocryptodira;
            Americhelydia; Chelonioidea; Cheloniidae; Lepidochelys.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_133261) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_965140265.1-RS_2025_04
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 04/18/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..2763
                     /organism="Lepidochelys kempii"
                     /mol_type="mRNA"
                     /isolate="rLepKem1"
                     /db_xref="taxon:8472"
                     /chromosome="6"
                     /geo_loc_name="USA: Quincy, Massachusetts"
                     /collection_date="2018-12-12"
     gene            1..2763
                     /gene="DICER1"
                     /note="dicer 1, ribonuclease III; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 2
                     Proteins"
                     /db_xref="GeneID:140913338"
     CDS             412..2679
                     /gene="DICER1"
                     /codon_start=1
                     /product="endoribonuclease Dicer isoform X4"
                     /protein_id="XP_073205654.1"
                     /db_xref="GeneID:140913338"
                     /translation="
MKSPALQSLSMAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNTGSGKTFIAVLLAKELSYQIRGDFNKNGKRTVFLVNSANQVAQQVSAVRTHSDLKVGEYSVLEIIESWTKEKWNQEFAKHEVLVMTCHVILNVLKNEYLSLSNINLLVFDECHLAIQDHPYQEIMKICENCPSCPRILGLTASILNGKCDPAELEEKIQKLEKILKSNAETATDLVVLDRYTSQPCEIVVDCGPYTDKSGLYERLLKELDEALNFLNDCNISVHSKERDSTLISKQILSDCRAVLVVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTFLRKIHALCEEHFSPASLDLKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDEDEEIEEKEKPETNFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEVEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPTEYRSYVQSKGRARAPISNYIMLADTDKIKSFEEDLKTYKAIEKILRNKCSKSVDTSETETESIVDDDDIFPPYVLRPDDSSPRVTINTAIGHINRYCARLPSDPFTHLAPKCKTRELPDTTFYSTLYLPINSPLRASIVGPPMSCARLAERVVALICCEKLHKIGELDDHLMPVGKETVKYEEELDLHDEEETNVPGRPGSTKRRQCYPKAEWC"
     misc_feature    535..1128
                     /gene="DICER1"
                     /note="DEXH-box helicase domain of endoribonuclease Dicer;
                     Region: DEXHc_dicer; cd18034"
                     /db_xref="CDD:350792"
     misc_feature    order(535..546,553..555,604..627,748..750,937..939,
                     1030..1032)
                     /gene="DICER1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350792"
     misc_feature    order(712..717,784..789,862..864,868..873,880..882,
                     955..963)
                     /gene="DICER1"
                     /note="nucleic acid binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:350792"
     misc_feature    1228..1506
                     /gene="DICER1"
                     /note="Partner-binding domain of the endoribonuclease
                     Dicer; Region: Dicer_PBD; cd15903"
                     /db_xref="CDD:277191"
     misc_feature    order(1237..1242,1249..1251,1255..1260,1435..1440,
                     1447..1452,1459..1461,1468..1473,1480..1482)
                     /gene="DICER1"
                     /note="Trbp binding interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:277191"
     misc_feature    1525..2103
                     /gene="DICER1"
                     /note="C-terminal helicase domain of the endoribonuclease
                     Dicer; Region: SF2_C_dicer; cd18802"
                     /db_xref="CDD:350189"
     misc_feature    order(1756..1764,1972..1974,2029..2031,2035..2037)
                     /gene="DICER1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:350189"
     misc_feature    order(1984..1986,1990..1992,2065..2067,2071..2073)
                     /gene="DICER1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:350189"
     misc_feature    2299..2565
                     /gene="DICER1"
                     /note="Dicer dimerization domain; Region: Dicer_dimer;
                     pfam03368"
                     /db_xref="CDD:460900"
ORIGIN      
aggaacctgacagctggggggagtgaggcggcggcggcggggaaatggcggcgggagcagcacaatgagacgcggcctgtagtctggaagctctgggctgggtccagtccggcaggttacctagggtgaaacaaaattacaggcttggaaactctggaaaagctctgtagcagcattagagagcagaagcttgcaaatgatgcaattaatgtacaaactgatatcatgatgtcaaaatgcagttcaaagaacacaaacacagatctcagaaattaaaacgcaggtcaggaagaatccgtcaggaactccagctgttgacaatactacatgggttatagaggaagctcttcagaggcagtaagctgtgctggaacaaaaatgcaatgaaagaaacactggatgaatgaatgaatgaaaagccctgctttgcaatccctcagcatggcaggactgcagcttatgacccctgcttcctcaccaatgggtcctttttttggactgccatggcaacaagaagcaattcatgataacatttacacgccaagaaaatatcaggttgaactgcttgaagcagctttggatcataatacgatagtctgtttaaacactggctcagggaagacttttattgcagtactacttgctaaagagctgtcctatcagatcaggggagacttcaacaaaaatggaaagagaacagttttcttggtcaactcagcaaatcaagttgctcagcaagtgtcagctgtcaggacccattcagatctgaaggtgggggagtattcagttttagaaataattgaatcatggacaaaggagaagtggaatcaagaatttgctaaacatgaggttctggttatgacatgtcatgtcattttgaatgttttaaaaaatgaatacttatccctgtcaaacattaatcttctggtgtttgatgagtgccatcttgcaatccaggaccatccgtatcaagaaattatgaagatctgtgagaactgtccatcctgtcctcgaatcctgggattaacagcttccattttaaatgggaaatgtgatcctgctgagttagaggagaagattcagaaactggagaaaatcctaaagagcaatgctgaaactgcaactgatttggtggtcttagatagatatacttctcagccatgtgagattgtggtagattgtggaccatataccgacaaaagcgggctgtatgaaagattgttaaaagaattggatgaagcacttaactttttaaatgactgcaacatatctgtacattcaaaagaaagagactctacgttaatttctaaacagatactgtcagactgtcgagctgtgttggttgttctgggaccctggtgtgcagataaggtagctggaatgatggtgagagagctacagaagtacatcaaacatgagcaagaggagctgcacaggaaatttttattgtttacagacactttcctaaggaaaatacatgcactgtgtgaagagcacttctcacctgcctcacttgatctgaaatttgtaaccccgaaagtaataaaactgcttgaaatcttgcgcaaatataaaccatatgagcggcagcagtttgaaagtgttgagtggtataataataggaatcaggataattatgtgtcttggagtgattctgaagatgatgatgaggatgaagaaattgaggagaaagaaaagccagagacaaatttcccttctccctttactaatattttatgtggaattatttttgtggaaaggagatacacagcagtcgtcctaaacaggttgataaaggaagctggaaaacaggatccagaactggcttacatcagtagcaattttataactggacatggcattggaaagaatcagcctcgtaacaaacagatggaagtggaattcagaaaacaagaagaggtacttagaaaatttcgagcacatgagaccaacttacttattgctactagtattgttgaagagggtgttgacataccaaaatgcaatttggtggttcgttttgatttgcccacagaataccgttcctatgtgcagtccaaaggaagagccagggcaccaatctcaaattacatcatgttagcagacacagacaaaatcaaaagttttgaagaagatcttaaaacctacaaagcaattgagaagatcctcagaaacaaatgctcaaagtccgttgatactagtgaaactgaaactgaatccatcgtggatgatgatgatatctttccaccctatgtgttgaggccagatgatagcagtccaagagttacaattaacactgcgattggacacatcaataggtactgcgcaagattaccaagcgatccatttactcatctggctcctaagtgtaaaacccgagaactgcctgatactacattttattcaactctctacctgccaatcaactcacctcttcgagcctctattgttggtcctccaatgagttgtgcaagactggctgagagagtggtagctcttatttgctgtgaaaagcttcacaaaattggtgaactggatgaccacttgatgccggttgggaaagaaacggttaagtatgaggaggagcttgatttacatgatgaagaagaaaccaatgttccaggaagaccaggatctacaaaacgaaggcagtgctaccctaaagctgaatggtgttaactacccctttgcctgacgagctcaactttaggaggcgaaagctgtatcctcctgaggatacaacaagatgctttggaatactga
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]