LOCUS       XM_072434341             723 bp    mRNA    linear   VRT 24-MAR-2025
DEFINITION  PREDICTED: Eucyclogobius newberryi uncharacterized protein
            (LOC140348353), mRNA.
ACCESSION   XM_072434341
VERSION     XM_072434341.1
DBLINK      BioProject: PRJNA1237740
KEYWORDS    RefSeq; includes ab initio.
SOURCE      Eucyclogobius newberryi (tidewater goby)
  ORGANISM  Eucyclogobius newberryi
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Gobiaria; Gobiiformes; Gobioidei; Gobiidae;
            Gobionellinae; Eucyclogobius.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_027315735) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_026437365.1-RS_2025_03
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 03/19/2025
            ##Genome-Annotation-Data-END##
            
            ##RefSeq-Attributes-START##
            ab initio :: 35% of CDS bases
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..723
                     /organism="Eucyclogobius newberryi"
                     /mol_type="mRNA"
                     /isolate="DKJ021-1_F"
                     /db_xref="taxon:166745"
                     /chromosome="Unknown"
                     /tissue_type="fin"
                     /dev_stage="adult"
                     /lat_lon="34.03839 N 118.5831 W"
     gene            1..723
                     /gene="LOC140348353"
                     /note="uncharacterized LOC140348353; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1
                     Protein"
                     /db_xref="GeneID:140348353"
     CDS             1..723
                     /gene="LOC140348353"
                     /codon_start=1
                     /product="uncharacterized protein"
                     /protein_id="XP_072290442.1"
                     /db_xref="GeneID:140348353"
                     /translation="

MYVITYVIIYVIMYVITYVIMYVIMHVITYVITYVIMYVITYVITYVIMYVITYVIMYVIMYVIIYVIMYVIMYVIMYVIMYVITYVIMYVIMYVIMYVITYVITYVITYVIMYVIMYVIMYVIMYVFIIIYVIMYVIMYVIMYVIMCVIMYVFIIIRATPSLLLFSEVKEKRGSALCVSMATLSPNVSTAFQQSRALRGSILSKHADCAMARLTPHGTRHATPHAMPHGTPHARPTARL"

ORIGIN      

atgtatgttatcacgtatgttatcatatatgttattatgtatgttattacgtatgttatcatgtatgttattatgcatgttattacgtatgttattacttatgttatcatgtatgttatcacgtatgttatcacgtatgttattatgtatgttatcacgtatgttattatgtatgttattatgtatgttatcatatatgttatcatgtatgttattatgtatgttattatgtatgttatcatgtatgttattacgtatgttatcatgtatgttatcatgtatgttattatgtatgttattacgtatgttatcacgtatgttatcacgtatgttatcatgtatgttattatgtatgttatcatgtatgttattatgtatgtatttatcattatatatgttattatgtatgttattatgtatgttattatgtatgttattatgtgtgttattatgtatgtatttattattatccgagccaccccatcactgctcctgttctctgaagtgaaagagaaacgaggctccgctctctgcgtctccatggcaaccctatctcccaacgtctccacagcctttcaacagtcgagagccctccgcggcagcatcctctccaaacatgcagattgtgccatggcgaggctcacgccccacggcacgcgccacgccacgccccacgccatgccccacggcacgccccacgcacgccccacggcacgcctgtga

//