GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-01-25 22:19:00, GGRNA.v2 : RefSeq release 232 (Sep, 2025)

LOCUS       XM_070847585            1116 bp    mRNA    linear   VRT 11-JAN-2025
DEFINITION  PREDICTED: Pempheris klunzingeri aspartate dehydrogenase domain
            containing (aspdh), transcript variant X1, mRNA.
ACCESSION   XM_070847585
VERSION     XM_070847585.1
DBLINK      BioProject: PRJNA1208050
KEYWORDS    RefSeq.
SOURCE      Pempheris klunzingeri
  ORGANISM  Pempheris klunzingeri
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
            Acanthomorphata; Eupercaria; Acropomatiformes; Pempheridae;
            Pempheris.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_092028) annotated using gene prediction method: Gnomon.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Full annotation
            Annotation Name             :: GCF_042242105.1-RS_2025_01
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.3
            Annotation Method           :: Gnomon; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 01/10/2025
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1116
                     /organism="Pempheris klunzingeri"
                     /mol_type="mRNA"
                     /isolate="RE-2024b"
                     /specimen_voucher="WAM P35483.003"
                     /db_xref="taxon:3127111"
                     /chromosome="17"
                     /tissue_type="Whole fish"
                     /dev_stage="adult"
                     /geo_loc_name="Australia: Western Australia, New Year
                     Island"
                     /collection_date="2023-03-28"
     gene            1..1116
                     /gene="aspdh"
                     /note="aspartate dehydrogenase domain containing; Derived
                     by automated computational analysis using gene prediction
                     method: Gnomon. Supporting evidence includes similarity
                     to: 10 Proteins"
                     /db_xref="GeneID:139216465"
     CDS             154..990
                     /gene="aspdh"
                     /codon_start=1
                     /product="aspartate dehydrogenase domain-containing
                     protein"
                     /protein_id="XP_070703686.1"
                     /db_xref="GeneID:139216465"
                     /translation="
MATSSSPLRVGVVGYGHLGQYLVERILRDGSALGLTLAFVWNRNLDKLRGLFPDELILGDLSSFADRRCDVIVEVCHPQIVKEFGIHFLSHSHFMVGSPSALSDPDLNQKLRQAAQQSGRTLYVPSGALWGGQDIQRLNDSGTLKALFIRMSKHPSCFRLTGDVLSDWTEDEGRHVLFRGSVAELCPLAPNNVNTMAAAAVAAGTLGFTGVQGEIVSDTALSDYHVVEVEVTGPDGFLVHTVRRNPAKLGAVTGSATYNSFWNSLLVCKGHGGRVYLC"
     misc_feature    175..894
                     /gene="aspdh"
                     /note="L-aspartate dehydrogenase, NAD(P)-dependent [Amino
                     acid transport and metabolism]; Region: AspD; COG1712"
                     /db_xref="CDD:441318"
ORIGIN      
acctggtgagtagagcaataaatagtatgtgttatattggacaagaagagattgtggaggatcagataggaagtaaggtcaaaagcagacatgtatgtgtctgtattggtttgtgttgcaggtgaaaggtttgggctattctgagcacaggacatggcaaccagctcttcccccctgagggttggagttgtaggatatggacatctagggcagtatctggtggagaggatccttagagatggatctgctcttggtctaactctggctttcgtttggaacagaaatttggacaagctcagaggtttatttcctgatgaactcatacttggtgatctatcatcctttgcagacagacgatgtgatgtgatcgtagaggtttgccatccgcagatagtgaaagaatttgggattcacttcctgtctcattcccatttcatggttggctctccctctgccctctctgatcctgatctgaaccagaagctgcgtcaggcagctcagcagtctggtaggacactctatgtccccagtggtgcattatggggaggccaggacatccagaggttgaatgatagtggcaccttgaaggctttgtttataagaatgtccaagcatccatcctgtttccggctaacaggagatgtcctctctgattggacggaggacgagggcagacatgttttgttcagaggctccgtggcagagttgtgcccacttgctccaaacaatgttaacaccatggcggcggcagcagtggcagcaggaacactcggttttactggcgttcagggagagattgtgtctgacacagcgttaagtgactaccatgtggtggaagtggaggtgactgggcctgatggcttcttagtacacacagtcaggaggaatccagccaaacttggagctgtaacgggcagcgcaacgtacaactccttctggaatagtttacttgtttgcaaaggtcatggaggccgagtgtacttgtgctaaagcggatgcctgattaactacgacacagacagaagactcactgtattgtggatattgtgtggatggtgtcactggatcagtatgttactgagaaaccttgaatatttgtgttccaataaactgcaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]