2025-07-02 19:18:16, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS XM_068352316 450 bp mRNA linear INV 16-SEP-2024 DEFINITION PREDICTED: Palaemon carinicauda uncharacterized protein (LOC137621809), mRNA. ACCESSION XM_068352316 VERSION XM_068352316.1 DBLINK BioProject: PRJNA1159288 KEYWORDS RefSeq; includes ab initio. SOURCE Palaemon carinicauda ORGANISM Palaemon carinicauda Eukaryota; Metazoa; Ecdysozoa; Arthropoda; Crustacea; Multicrustacea; Malacostraca; Eumalacostraca; Eucarida; Decapoda; Pleocyemata; Caridea; Palaemonoidea; Palaemonidae; Palaemon. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_090752) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Full annotation Annotation Name :: GCF_036898095.1-RS_2024_09 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.3 Annotation Method :: Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 09/11/2024 ##Genome-Annotation-Data-END## ##RefSeq-Attributes-START## ab initio :: 23% of CDS bases ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..450 /organism="Palaemon carinicauda" /mol_type="mRNA" /isolate="YSFRI2023" /isolation_source="Closed colony" /db_xref="taxon:392227" /chromosome="28" /tissue_type="muscle" /geo_loc_name="China: Rizhao, Shandong" /collection_date="2020-10" gene 1..450 /gene="LOC137621809" /note="uncharacterized LOC137621809; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 7 Proteins" /db_xref="GeneID:137621809" CDS 1..450 /gene="LOC137621809" /codon_start=1 /product="uncharacterized protein" /protein_id="XP_068208417.1" /db_xref="GeneID:137621809" /translation="
MKGLIVVVCAVLFTKSQGRGVEDGRLVAAYSTRTVLTLTTITSEHPLTCVVNPGIANCGKRRFRRYRISIRGDFDEKLAGLESSLDEEDLEIDEKSPSSSTRDGRIALTVWTTSSSTFTITSTSVNTSTTFSLSYYCTVAGASFPPACG"
ORIGIN
atgaaggggcttattgttgttgtttgtgccgtcctgtttacaaaaagccagggacgaggcgtcgaagatggccggctggtggccgcttactcgactcgaaccgtgctcaccctaactacaatcacttcggagcaccccctcacctgtgtcgtgaatccaggcatagctaactgtgggaagagacgatttcgacgttacaggatcagtattcgcggtgacttcgacgaaaagctagcaggactcgagagctccttggacgaggaggacctcgagatagacgaaaagtcgccctcctcctcaacccgcgatggtcgaatagccttgacggtttggacgacctcgtcctcgacctttactataacttcgacctcggtcaatacctccactacattctcgctctcctattactgcaccgtggcaggggccagtttcccccctgcttgtggataa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]